Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCCTATGTGGTCAGCTCAGTATCCGATGCTGGTATGACAAGGACGGGCGGCTGCTCCAGGAGTTTAACAAGATCGAGCCCCCCCTGATCTTTGAGTGTAACCAGGCATGCTCCTGCTGGAGAAGCTGCAAGAACCGCGTGGTGCAGAGCGGCATCAAGGTACGGCTGCAGCTCTACCGGACTGCCAAGATGGGCTGGGGGGTCCGAGCCTTGCAGACCATCCCCCAGGGCACGTTCATCTGCGAGTATGTAGGAGAGCTGATCTCTGATGCCGAGGCTGATGTGAGAGAGGATGATTCTTACCTCTTCGATTTAGATAACAAGGATGGCGAGGTTTACTGCATTGATGCCCGTTACTATGGCAACATCAGCCGATTCATTAACCACCTGTGTGACCCCAACATCATCCCTGTCCGGGTTTTCATGCTGCACCAAGA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EHMT2(110147), Ehmt2(110147)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shuli Liu et al.
Oncotarget, 6(9), 6887-6901 (2015-03-10)
Head and neck squamous cell carcinoma (HNSCC) is a particularly aggressive cancer with poor prognosis, largely due to lymph node metastasis and local recurrence. Emerging evidence suggests that epithelial-to-mesenchymal transition (EMT) is important for cancer metastasis, and correlated with increased
Yize Li et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(13), 1902402-1902402 (2020-07-17)
Nerve injury-induced change in gene expression in primary sensory neurons of dorsal root ganglion (DRG) is critical for neuropathic pain genesis. N6-methyladenosine (m6A) modification of RNA represents an additional layer of gene regulation. Here, it is reported that peripheral nerve
Kee-Beom Kim et al.
Nucleic acids research, 43(7), 3509-3523 (2015-03-15)
Histone H3K9 methyltransferase (HMTase) G9a-mediated transcriptional repression is a major epigenetic silencing mechanism. UHRF1 (ubiquitin-like with PHD and ring finger domains 1) binds to hemimethylated DNA and plays an essential role in the maintenance of DNA methylation. Here, we provide
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU050951-20UG | 04061828510627 |
| EMU050951-50UG | 04061828285198 |