Skip to Content
Merck
CN

EMU051511

MISSION® esiRNA

targeting mouse Brd4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAAGTGCTGCAGTGGCATCCTCAAGGAGATGTTTGCCAAGAAACATGCTGCCTATGCCTGGCCTTTCTACAAGCCTGTGGATGTGGAGGCACTGGGTCTGCACGACTACTGTGACATCATCAAACATCCCATGGACATGAGCACAATCAAGTCTAAACTAGAGTCCCGAGAGTACAGAGATGCCCAGGAATTTGGTGCTGATGTCCGATTGATGTTCTCCAACTGCTACAAGTACAACCCCCCTGACCATGAAGTGGTAGCCATGGCTCGAAAACTCCAGGATGTGTTTGAAATGCGCTTTGCCAAGATGCCTGATGAGCCTGAAGAGCCAGTTGTTACAGTGTCCTCTCCTGCAGTGCCACCCCCTACAAAGGTGGTAGCCCCACCCTCATCTAGTGACAGCAGCAGCGACAGTTCTTCCGACAGCGACAGTTCCACTGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Vaibhav Sahai et al.
Molecular cancer therapeutics, 13(7), 1907-1917 (2014-05-09)
Pancreatic ductal adenocarcinoma (PDAC) is associated with pronounced fibrosis that contributes to chemoresistance, in part, through increased histone acetylation. Because bromodomain (BRD) and extra terminal domain (BET) proteins are "readers" of histone acetylation marks, we targeted BET proteins in PDAC
Deepanwita Sengupta et al.
Epigenetics, 10(6), 460-466 (2015-05-06)
Pathologic c-Myc expression is frequently detected in human cancers, including Merkel cell carcinoma (MCC), an aggressive skin cancer with no cure for metastatic disease. Bromodomain protein 4 (BRD4) regulates gene transcription by binding to acetylated histone H3 lysine 27 (H3K27Ac)
W Liu et al.
Cell death and differentiation, 21(12), 1950-1960 (2014-08-26)
Bromodomain-containing protein 4 (BRD4) is an important epigenetic reader implicated in the pathogenesis of a number of different cancers and other diseases. Brd4-null mouse embryos die shortly after implantation and are compromised in their ability to maintain the inner cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service