Skip to Content
Merck
CN

EMU051841

MISSION® esiRNA

targeting mouse Grem1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCTGCAAGCCCAAGAAGTTCACCACCATGATGGTCACACTCAACTGTCCTGAGCTACAGCCACCCACCAAGAAGAAAAGGGTCACACGCGTGAAGCAGTGCCGTTGCATATCCATCGACTTGGATTAAGTCAAAGCGGGCACATTCAGCCTGTCATAGCCATGCTGAGAGAGCCACACCCAAACCACCCGATTCCTACTTGGCTTAAACCTAGAGGCCAGAAGAACCAGCAGTTGCTTCCTGGCTGGAGGCTGCTTATGCATAGTGTATGCGCATGAGTGTGCATGGGTGCCTGTGGGTGTTTCCAAACACCAGCCGGAAACAGCCTTTGCTAGAAGGCACTTCCTGTTACTCTGCTTCAGATGGTCGGAAATGCCCACACCACTGGACCCAAACATCCACAGGGGCAGGGCTGTAGTTGGCTTTGTCATTGTGTTCCATGTGCCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nam Ji Sung et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Gremlin-1 (GREM1), one of the bone morphogenetic protein (BMP) antagonists, can directly bind to BMPs. GREM1 is involved in organogenesis, tissue differentiation, and organ fibrosis. Recently, numerous studies have reported the oncogenic role of GREM1 in cancer. However, the role
Na Hui Kim et al.
Biochemical and biophysical research communications, 533(4), 1378-1384 (2020-10-25)
Gremlin-1 (GREM1), one of the antagonists of bone morphogenetic proteins (BMPs), has recently been reported to be overexpressed in a variety of cancers including breast cancer. GREM1 is involved in tumor promotion, but little is known about its role in
Julie R Graham et al.
Journal of cellular biochemistry, 115(9), 1539-1548 (2014-03-19)
Fibrosis is a chronic disease characterized by an excessive deposition of scar tissue in the affected organs. A central mediator of this process is transforming growth factor-β (TGF-β), which stimulates the production of extracellular matrix proteins such as collagens. MicroRNAs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service