Skip to Content
Merck
CN

EMU056441

MISSION® esiRNA

targeting mouse Eif2c2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

form

lyophilized powder

description

Powered by Eupheria Biotech

product line

MISSION®

esiRNA cDNA target sequence

AGCGTTTTACAAGGCACAGCCAGTGATCGAGTTTGTTTGTGAAGTTTTGGATTTTAAAAGTATTGAAGAACAACAAAAACCTCTGACAGATTCCCAAAGGGTAAAGTTTACCAAAGAAATCAAAGGTCTAAAGGTGGAGATAACGCACTGTGGTCAGATGAAGAGGAAGTACCGTGTCTGCAATGTGACCCGGCGGCCTGCCAGTCACCAAACGTTCCCACTGCAGCAGGAGAGTGGGCAGACAGTGGAGTGTACAGTGGCCCAGTACTTCAAGGACAGGCACAAGCTGGTTCTGCGCTACCCCCACCTCCCGTGTTTACAAGTCGGACAGGAGCAGAAACACACCTACCTTCCTTTGGAGGTCTGTAACATAGTTGCTGGACAGAGATGTATAAAAAAATTAACAGACGATCAGACCTCAACCATGATCAGAGCAACTGCCAGGTCAGCACCTGATCGCCAAGAGGAGATCAGCAAACTGATGCGAAGTGCAAGTTTCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji Hoon Jung et al.
Cancer biology & therapy, 16(3), 412-419 (2015-02-19)
Oncogene MYC is deregulated in many human cancers, especially in lymphoma. Previously, we showed that inauhzin (INZ) activates p53 and inhibits tumor growth. However, whether INZ could suppress cancer cell growth independently of p53 activity is still elusive. Here, we
Peiyao Li et al.
BMC cancer, 15, 862-862 (2015-11-08)
Argonaute 2 (AGO2), a central component of RNA-induced silencing complex, plays critical roles in cancer. We examined whether the single nucleotide polymorphisms (SNPs) of AGO2 were related to the risk of nasopharyngeal carcinoma (NPC). Twenty-five tag SNPs within AGO2 were
Je-Hyun Yoon et al.
Genes & development, 29(15), 1599-1604 (2015-08-09)
Eukaryotic gene expression is tightly regulated post-transcriptionally by RNA-binding proteins (RBPs) and microRNAs. The RBP AU-rich-binding factor 1 (AUF1) isoform p37 was found to have high affinity for the microRNA let-7b in vitro (Kd = ∼ 6 nM) in cells.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service