Skip to Content
Merck
CN

EMU057051

MISSION® esiRNA

targeting mouse Usp7

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Usp7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCTAAGGACCCTGCAAATTATATTCTCCATGCAGTCTTGGTTCACAGTGGAGATAATCATGGTGGACATTACGTGGTTTACCTAAACCCCAAAGGGGATGGCAAATGGTGTAAGTTCGATGATGACGTGGTATCCAGGTGTACTAAAGAAGAAGCCATTGAGCACAATTATGGGGGTCATGATGATGATCTGTCTGTTCGACACTGCACAAATGCCTATATGTTAGTGTACATCAGGGAATCAAAGCTAAGTGAAGTGTTACAAGCTGTCACCGACCATGATATTCCTCAGCAGTTGGTGGAACGATTGCAAGAAGAGAAAAGGATCGAGGCTCAGAAGCGGAAGGAGCGGCAGGAAGCCCATCTCTACATGCAAGTGCAGATAGTTGCAGAGGACCAGTTTTGTGGCCACCAAGGAAATGACATGTACGACGAGGAGAAAGTGAGGTACACTGTGTTCAAGGTTCTGAAGAACTCCTCCCTGGCCGAGTTTGTTCAGAGCCTCTCCCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Serena Giovinazzi et al.
Oncotarget, 5(11), 3728-3742 (2014-07-09)
USP7 (Ubiquitin Specific processing Protease-7) is a deubiquitinase which, over the past decade emerged as a critical regulator of cellular processes. Deregulation of USP7 activity has been linked to cancer, making USP7 inhibition an appealing anti-cancer strategy. The identification of
Key-Hwan Lim et al.
Scientific reports, 5, 12793-12793 (2015-08-05)
HAUSP (herpes virus-associated ubiquitin specific protease, known as ubiquitin specific protease 7), one of DUBs, regulates the dynamics of the p53 and Mdm2 network in response to DNA damage by deubiquitinating both p53 and its E3 ubiquitin ligase, Mdm2. Its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service