Merck
CN
All Photos(1)

Documents

Safety Information

EMU059761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gsk3b

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGCCACAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCATCGAGACAT

Ensembl | mouse accession no.

ENSMUSG00000022812

NCBI accession no.

NM_019827

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... GSK3B(56637) , Gsk3b(56637)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Yunfeng Fu et al.
OncoTargets and therapy, 7, 1159-1168 (2014-07-17)
Glycogen synthase kinase-3 (GSK-3) plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/β(Tyr279/216) in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
I Azoulay-Alfaguter et al.
Oncogene, 34(35), 4613-4623 (2014-12-17)
There is controversy over the role of glycogen synthase kinase-3 (GSK-3) in cancer progression. Recent work has implicated GSK-3 in the regulation of mammalian target of rapamycin (mTOR), a known player in malignant transformation. Autophagy, a self-degradation pathway, is inhibited

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service