Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGAGAAGCAGCAGTGAGCACGTTGCTTTAGAGCAGCACTCCATCCTCCCAGGTGGAGCAGACCATCTCAGAAACATTTGACAGCTGTTTGTTTATTTTAATAGTAAGTTCTCAATGTGTAGGATGCTGCCACAAACTTCAGTGTATGAATTTGACACTTACTGTCTGTGACAGGTTAGCATAATGTGTGTACATAGGGATGAGTTGTCTTGAAGATCTATTTTTAAGTACTGTTGTAATTGTTCCCCTCTACTGTCAAAACTCTAGCAAGGCATGTCAGAGCAGCTGACCTCCCCAGTGCTGTGATGTGTGAGCAGCTGACCTCCCCAGTGCTGGGATGTGTGAATGTGTTTACAGAGCTGATTTGACAGTCGCTAGAATTGGCAGAGGAACGTTCAC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... RNMT(67897), Rnmt(67897)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU060181-20UG | 04061828471409 |
| EMU060181-50UG | 04061828246090 |