EMU060431
MISSION® esiRNA
targeting mouse Traf2
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAATGATGCTCTGTTGCAGTGGCCTTTTAATCAGAAGGTAACATTGATGTTGCTGGACCATAACAACCGGGAGCATGTGATCGACGCATTCAGGCCCGATGTAACCTCGTCCTCCTTCCAGAGGCCTGTCAGTGACATGAACATCGCCAGTGGCTGCCCCCTCTTCTGCCCTGTGTCCAAGATGGAGGCCAAGAATTCCTATGTGCGGGATGATGCGATCTTCATCAAAGCTATTGTGGACCTAACAGGACTCTAGCCACCCCTGCTAAGAATAGCAGCTCAGTGAGGAGCTGTCACATTAGGCCAGCCAGGCCCTGCCACACACGGGTGGGCAGGCTTGGTGTAAATGCTGGGGAGGGCCTCAGCCTAGAGCCAATCACCATCACACAGAAAGGCAGGA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TRAF2(22030), Traf2(22030)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU060431-20UG | 04061828471652 |
| EMU060431-50UG | 04061828246342 |