EMU064851
MISSION® esiRNA
targeting mouse Mapk3
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACACGCAGCTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCAGCTTATGACCACGTGCGCAAGACCAGAGTGGCCATCAAGAAGATCAGCCCCTTTGAGCATCAAACCTACTGTCAGCGCACGCTGAGGGAGATCCAGATCTTGCTGCGATTCCGCCATGAGAATGTTATAGGCATCCGAGACATCCTCAGAGCGCCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTCAGGACCTCATGGAGACAGACCTGTACAAGCTGCTTAAAAGCCAGCAGCTGAGCAATGACCACATCTGCTACTTCCTCTACCAGATCCTCCGGGGCCTCAAGTATATACACTCAGCCAATGTGCTGCACCGGGACCTGAAGCCTTCCAATCTGCTTATCAACACCACCTGCGA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... MAPK3(26417), Mapk3(26417)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Juan Zhao et al.
PloS one, 9(10), e108005-e108005 (2014-10-11)
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine-induced hepatic cirrhosis and examined the effects of
Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU064851-50UG | 04061828266388 |
| EMU064851-20UG | 04061831338959 |