EMU066761
MISSION® esiRNA
targeting mouse Fyb
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGCCTCAGACTTCCCTCCTCCACCTGCAGAGATGAGTCAAGGAATGAGTGTTGGAAGGGCAAAAACGGAAGAGAAAGATCCCAAGAAGCTAAAAAAGCAAGAAAAGGAAGAAAAAGACCTCAGGAAAAAATTTAAGTACGACGGTGAAATTCGAGTTCTATATTCAACTAAAGTTGCGTCCTCCTTAACCTCTAAAAAGTGGGGAGCGAGAGATCTGCAGATAAAACCTGGGGAGTCACTCGAAGTTATACAAAGCACAGATGACACCAAAGTTCTCTGCAGGAATGAAGAGGGCAAATATGGTTATGTCCTTCGGAGTTACCTGGTGGACAATGATGGAGAAATCTATGACGACATCGCTGATGGTTGCATCTATGACAATGACTAGCACTCTGCTCTGTTCATTCCACTGTGCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FYB(23880), Fyb(23880)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mahmoud A Chawsheen et al.
Cellular signalling, 81, 109934-109934 (2021-02-06)
Lung cancer has a poor prognosis partly due to a lack of response to treatments such as the chemotherapy drug gemcitabine. Combinations of chemotherapy drugs with signal transduction inhibitors may be more effective treatments. In this study we have investigated
Fang Wang et al.
Folia histochemica et cytobiologica, 58(2), 96-107 (2020-06-27)
Growing evidence indicates that Rictor (Rapamycin-insensitive companion of mTOR) is overexpressed across several malignancies and associated with poor survival. However, only limited data indicate that Rictor plays a role in gastric cancer (GC). We sought to explore the prognostic value
Li Feng et al.
Pharmaceutical biology, 57(1), 586-594 (2019-09-08)
Context: Evidence suggests that microRNA (miRNA) regulate gene expression and bone tissue homoeostasis of osteoporosis. MiR-152 has found to be abnormally expressed in osteoporosis, but its role in osteoblast differentiation has not been elucidated. Objective: To understand the potential mechanism
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU066761-50UG | 04061828250820 |
| EMU066761-20UG | 04061828476367 |