EMU069631
MISSION® esiRNA
targeting mouse Stra13
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATTTGCACTTCAGGGATTGCAAGACCAAAGTCAGCGGGGATGCACTGCAGCTCATGGCGGAGTTCCTGAGGATCTTCGTACTAGAGGCTGCTGTCCGTGGGGTCTGGCAGGCCCAGGCAGAAGACCTGGATGTTGTGGAAGTGGATCAGCTGGAGAAAGTGCTCCCTCAGCTGCTCCTGGACTTCTAGAGTTCCCTCCTGTGGCCTGCAAGGTCTAGTGAATCCACACCAGCATCAACTCCTGAGCTCTCCAGCTTCAGGAGGATGGGAAGATCCCAGCAGCTGTTACCTCCAAGAGTCCTTGCAAGACAGGTGCAGGGAAAGGTGAACCAGCCTGCCTCCAGACACAGCCCTCCTCCCGCCCCCAGCAGCCTTGCATTATAAATAAACCAGCTGCTGGCAGTGCTCCTTCTTGCCACCCTACA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... STRA13(20892), Stra13(20892)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiang Liu et al.
International journal of molecular medicine, 38(6), 1727-1733 (2016-11-15)
The functions of basic helix-loop-helix (bHLH) transcription factor-differentiated embryonic chondrocyte (DEC)1 (BHLHE40) and 2 (BHLHE41) are involved in various fields such as circadian rhythms, immune responses, cell proliferation, hypoxia reaction as well as malignant tumors. Previous findings showed that DEC served as apoptosis regulators
Rui Ning et al.
Frontiers in pharmacology, 8, 866-866 (2017-12-14)
Inflammatory burden is a primary cellular event in many liver diseases, and the overall capacity of drug elimination is decreased. PXR (pregnane X receptor) and CAR (constitutive androstane receptor) are two master regulators of genes encoding drug-metabolizing enzymes and transporters.
Aarti Sethuraman et al.
Breast cancer research : BCR, 20(1), 117-117 (2018-10-05)
Metastasis is responsible for a significant number of breast cancer-related deaths. Hypoxia, a primary driving force of cancer metastasis, induces the expression of BHLHE40, a transcription regulator. This study aimed to elucidate the function of BHLHE40 in the metastatic process
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU069631-20UG | 04061828479078 |
| EMU069631-50UG | 04061828253661 |