Skip to Content
Merck
CN

EMU070621

MISSION® esiRNA

targeting mouse Sgk3

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGAGAGCTGCCCAAGTGTAAGCATTCCCAGCTCTGACGAACACAGAGAGAAAAAGAAGAGGTTCACGGTTTATAAAGTTCTGGTCTCTGTGGGCAGAAGCGAGTGGTTTGTCTTCAGGAGATACGCAGAGTTTGACAAACTTTACAATTCTTTAAAGAAGCAGTTTCCTGCTATGGCTCTGAAGATTCCTGCCAAGAGAATATTTGGTGATAATTTTGATCCAGATTTTATTAAACAAAGAAGAGCAGGATTGAATGAGTTCATTCAGAACTTGGTCAGATATCCAGAGCTTTACAACCATCCAGATGTCCGAGCATTCCTTCAAATGGACAGCCCAAGACATCAGTCAGATCCATCTGAAGATGAGGATGAAAGAAGTACTTCGAAGCCACATTCTACCTCACGGAACATCAACCTGGGACCAAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Huailei Liu et al.
Journal of neuro-oncology, 122(3), 431-439 (2015-02-28)
Glioblastoma multiforme (GBM) is the most malignant brain tumor in humans. Previous studies have demonstrated that microRNA plays important roles in the development and proliferation of GBM cells. Here we defined the mechanism by which miR-212-3p regulated the proliferation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service