Skip to Content
Merck
CN

EMU071911

MISSION® esiRNA

targeting mouse Ezr

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTTAAATTCCGGGCCAAGTTCTACCCCGAAGACGTGGCCGAGGAACTCATCCAGGACATCACACAGAAGCTCTTCTTCCTGCAAGTCAAGGACGGGATCCTCAGCGACGAGATCTACTGCCCCCCAGAGACAGCCGTGCTCCTGGGCTCCTATGCCGTTCAGGCCAAGTTCGGAGATTATAACAAGGAAATGCACAAGTCTGGGTACCTCAGCTCGGAGCGGCTGATCCCCCAGAGAGTCATGGACCAACACAAGCTCAGCAGGGACCAGTGGGAGGACCGGATCCAGGTGTGGCACGCGGAACACCGAGGGATGCTCAAGGACAGTGCTATGCTGGAATACCTGAAGATTGCCCAGGACCTGGAAATGTATGGGATCAACTATTTCGAGATCAAAAACAAGAAAGGAACAGACCTTTGGCTTGGAGTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

C Oneyama et al.
Oncogene, 35(4), 501-512 (2015-04-14)
c-Src is upregulated in various human cancers, suggesting its role in malignant progression. However, the molecular circuits of c-Src oncogenic signaling remain elusive. Here we show that Fer tyrosine kinase oligomer mediates and amplifies Src-induced tumor progression. Previously, we showed
N Ece Gungor-Ordueri et al.
Endocrinology, 155(10), 3981-3995 (2014-07-23)
During spermatogenesis, the transport of spermatids and the release of sperms at spermiation and the remodeling of the blood-testis barrier (BTB) in the seminiferous epithelium of rat testes require rapid reorganization of the actin-based cytoskeleton. However, the mechanism(s) and the
Rathangadhara Chakrapani Nammalwar et al.
Biochimica et biophysica acta, 1853(9), 2086-2094 (2015-01-03)
The cortical cytoskeleton constitutes an important subcellular structure that determines cell shape and regulates cell migration as well as membrane traffic to and from the plasma membrane. Many components of the cortical cytoskeleton have been identified including structural and scaffolding

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service