Skip to Content
Merck
CN

EMU071921

MISSION® esiRNA

targeting mouse Stat1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Takashi Shimizu et al.
Science signaling, 14(667) (2021-01-28)
Pulmonary arterial hypertension (PAH) is a fatal disease characterized by excessive pulmonary vascular remodeling. However, despite advances in therapeutic strategies, patients with PAH bearing mutations in the bone morphogenetic protein receptor type 2 (BMPR2)-encoding gene present severe phenotypes and outcomes.
EunBin Kong et al.
Cell death and differentiation, 27(8), 2517-2530 (2020-03-05)
Autophagy is a cellular catabolic process that maintains intracellular homeostasis using lysosomal degradation systems. We demonstrate that inhibiting autophagy by depleting essential autophagy elongation proteins, Atg5 or Atg7, induces ISG15 expression through STING-mediated cytosolic dsDNA response. Genome stability is impaired
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift
Shunsuke Fukuyo et al.
Rheumatology (Oxford, England), 53(7), 1282-1290 (2014-03-07)
The mechanisms of ectopic calcification in inflammatory diseases are poorly understood. We investigated the effects of inflammatory cytokines on the mechanisms of calcification in human adipose tissue-derived mesenchymal stem cells (hADSCs). The effects of inflammatory cytokines were evaluated using hADSCs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service