Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... STAT1(20846), Stat1(20846)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Takashi Shimizu et al.
Science signaling, 14(667) (2021-01-28)
Pulmonary arterial hypertension (PAH) is a fatal disease characterized by excessive pulmonary vascular remodeling. However, despite advances in therapeutic strategies, patients with PAH bearing mutations in the bone morphogenetic protein receptor type 2 (BMPR2)-encoding gene present severe phenotypes and outcomes.
EunBin Kong et al.
Cell death and differentiation, 27(8), 2517-2530 (2020-03-05)
Autophagy is a cellular catabolic process that maintains intracellular homeostasis using lysosomal degradation systems. We demonstrate that inhibiting autophagy by depleting essential autophagy elongation proteins, Atg5 or Atg7, induces ISG15 expression through STING-mediated cytosolic dsDNA response. Genome stability is impaired
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU071921-20UG | 04061831339369 |
| EMU071921-50UG | 04061828255894 |