Skip to Content
Merck
CN

EMU073651

MISSION® esiRNA

targeting mouse Fcgr3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAGATCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTACGTACGGAGAAATCTTCAAACCCCGAGGGAGTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCCTATGGCAAAACATACGATGTTTTGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAAGCAGGCCGGGATGTTTGGTTCTTCAATCACAACGACTTAGGATCACCAGTTCAAGGCTTGCTGGGTCACACAGAGAGAGTGAGTGCAAGTCTAGCCTGGATAACCCAGTGAGATCCTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

mouse ... Fcgr3(14131)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Martina Schmittnaegel et al.
Cancer immunology research, 3(7), 764-776 (2015-02-19)
Tumor cells escape immune eradication through multiple mechanisms, including loss of antigenicity and local suppression of effector lymphocytes. To counteract these obstacles, we aimed to direct the unique cytomegalovirus (CMV)-specific immune surveillance against tumor cells. We developed a novel generation
Siva K Gandhapudi et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3820-3828 (2015-03-18)
Although IL-18 has not previously been shown to promote T lymphopoiesis, results obtained via a novel data mining algorithm (global microarray meta-analysis) led us to explore a predicted role for this cytokine in T cell development. IL-18 is a member
Wai W Lin et al.
Science signaling, 8(392), ra88-ra88 (2015-09-04)
Tumor necrosis factor receptor-associated factor 3 (TRAF3) is an adaptor protein that inhibits signaling by CD40 and by the receptor for B cell-activating factor (BAFF) and negatively regulates homeostatic B cell survival. Loss-of-function mutations in TRAF3 are associated with human

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service