Skip to Content
Merck
CN

EMU074201

MISSION® esiRNA

targeting mouse Vdac1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Vdac1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGACGGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGAAGTTGGAGACTGCTGTCAATCTCGCCTGGACTGCAGGAAACAGTAACACTCGCTTCGGAATAGCAGCCAAGTATCAGGTCGACCCTGATGCCTGCTTTTCGGCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGCCCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTGTACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGGATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Meghraj Singh Baghel et al.
Molecular neurobiology, 56(3), 1707-1718 (2018-06-20)
Our previous report on hippocampal proteome analysis suggested the involvement of voltage-dependent anion channel (Vdac) 1 in scopolamine-induced amnesia. Further silencing of Vdac1 in young mice reduced the recognition memory. Vdac1 is a porin protein present abundantly on outer mitochondrial
A Mitra et al.
Cell death & disease, 4, e582-e582 (2013-04-06)
Cardiac hypertrophy and myocardial infarction (MI) are two major causes of heart failure with different etiologies. However, the molecular mechanisms associated with these two diseases are not yet fully understood. So, this study was designed to decipher the process of
Sergio Gonzalez et al.
The Journal of clinical investigation, 126(3), 1023-1038 (2016-02-16)
Schwann cells produce myelin sheath around peripheral nerve axons. Myelination is critical for rapid propagation of action potentials, as illustrated by the large number of acquired and hereditary peripheral neuropathies, such as diabetic neuropathy or Charcot-Marie-Tooth diseases, that are commonly

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service