Skip to Content
Merck
CN

EMU092131

MISSION® esiRNA

targeting mouse Ube2i

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAAGCAGCGGCCCTGGGCTCCATGACGAGGAAGGGATTGGCTTGGCAAGAACTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Marcel Kunadt et al.
Acta neuropathologica, 129(5), 695-713 (2015-03-18)
Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system.
Tanya M Spektor et al.
PloS one, 6(7), e22785-e22785 (2011-08-11)
PR-Set7/Set8/KMT5a is a chromatin-modifying enzyme that specifically monomethylates lysine 20 of histone H4 (H4K20me1). In this study we attempted to identify PR-Set7-interacting proteins reasoning that these proteins would provide important insights into the role of PR-Set7 in transcriptional regulation. Using
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Faxin Li et al.
Inflammation, 37(4), 1134-1141 (2014-02-18)
Rheumatoid arthritis (RA) is a chronic autoimmune disease with high morbidity and mortality. Fibroblast-like synoviocytes (FLS) in the synovial tissues play critical roles in joint destruction. Recent studies implicate the sumoylation in the regulation of the inflammation and arthritis. Thus

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service