EMU094441
MISSION® esiRNA
targeting mouse Ptprj
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTGGGTTTGCAGAGGAATATGAGGACCTGAAGCTGATTGGGATAAGTTTACCTAAATACACAGCTGAGATAGCCGAGAACAGAGGGAAGAACCGCTACAACAATGTTCTGCCCTATGATATTTCTCGAGTCAAACTTTCAGTCCAGACCCATTCGACAGATGACTACATCAATGCCAACTATATGCCTGGCTACCATTCCAAGAAAGATTTCATTGCCACACAAGGACCTTTACCCAACACTTTGAAAGATTTCTGGCGTATGGTTTGGGAGAAAAACGTATATGCCATTGTTATGTTGACCAAATGCGTGGAGCAGGGAAGGACCAAATGTGAGGAGTACTGGCCTTCCAAGCAGGCTCAGGACTACGGGGACATAACTGTGGCGATGACATCAGAAGTCGTTCTTCCAGAATGGACC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PTPRJ(19271), Ptprj(19271)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Gregory C Sartor et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(45), 15062-15072 (2015-11-13)
Epigenetic processes that regulate histone acetylation play an essential role in behavioral and molecular responses to cocaine. To date, however, only a small fraction of the mechanisms involved in the addiction-associated acetylome have been investigated. Members of the bromodomain and
K Spring et al.
Oncogene, 34(44), 5536-5547 (2015-03-17)
DEP-1/PTPRJ is a receptor-like protein tyrosine phosphatase mainly known for its antiproliferative and tumor-suppressive functions. Many identified substrates are growth factor receptors, and DEP-1 is deleted and/or mutated in human cancers including that of the breast. However, DEP-1 was also
Xiaoling Luo et al.
OncoTargets and therapy, 8, 3159-3167 (2015-11-26)
Interaction between microRNA (miR-328) and PTPRJ (protein tyrosine phosphatase, receptor type, J) has been reported to be responsible for miR-328-dependent increase in epithelial cancer cell proliferation. However, the role of miR-328 and PTPRJ in hepatocellular carcinoma (HCC) remains unclear. The
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU094441-20UG | 04061828532766 |
| EMU094441-50UG | 04061828870622 |