Key Documents

View All Documentation

EMU164891

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting mouse Npm1

Select a Size

Change View

About This Item

NACRES:

NA.51

UNSPSC Code:

41105324

Technical Service

Need help? Our team of experienced scientists is here for you.

Let Us Assist

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGGCTGTGAACTAAAGGCTGACAAAGACTATCACTTTAAAGTGGATAATGATGAAAATGAGCACCAGTTGTCATTAAGAACGGTCAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGTAGAGGCAGAAGCAATGAACTATGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAACCAACAGTTTCCCTAGGGGGCTTTGAAATTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAGGGCCTGTGCACATTAGTGGACAGCATCTAGTAGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGAGGAGGACGTAAAACTCTTAGGCATGTCTGGAAAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAGAAAAAAGTAAAACTTGATGAAGATGATGAGGACGATGATGAGGACGATGAGGATG

Ensembl | mouse accession no.

ENSMUSG00000057113

NCBI accession no.

NM_008722

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... NPM1(18148), Npm1(18148)

Related Categories

MISSION® esiRNA

Custom DNA & RNA Oligos

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oncogenic extracellular HSP70 disrupts the gap-junctional coupling between capillary cells.

Dominique Thuringer et al.

Oncotarget, 6(12), 10267-10283 (2015-04-15)

High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not

High glucose alters Cx43 expression and gap junction intercellular communication in retinal Müller cells: promotes Müller cell and pericyte apoptosis.

Tetsuya Muto et al.

Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)

To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes

Sulforaphane counteracts aggressiveness of pancreatic cancer driven by dysregulated Cx43-mediated gap junctional intercellular communication.

Tobias Forster et al.

Oncotarget, 5(6), 1621-1634 (2014-04-20)

The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and

Simvastatin protects Sertoli cells against cisplatin cytotoxicity through enhanced gap junction intercellular communication.

Lingzhi Wang et al.

Oncology reports, 34(4), 2133-2141 (2015-08-12)

Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of

Titration of the gap junction protein Connexin43 reduces atherogenesis.

S Morel et al.

Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)

Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine

View All Related Papers

Global Trade Item Number

SKU	GTIN
EMU164891-20UG	04061828749683
EMU164891-50UG	04061828698493

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service