Skip to Content
Merck
CN

HLTUD002C

MISSION® Lenti microRNA Inhibitor

cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences

Synonym(s):

Tough Decoy, TuD

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
CGGUACGAUCGCGGCGGGAUAUC
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


Quality Level

product line

MISSION®

form

liquid

concentration

≥1x106 VP/ml (via p24 assay)

mature sequence

CGGUACGAUCGCGGCGGGAUAUC

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Other Notes

Based on miRBase V19 Mature ID

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Still not finding the right product?

Explore all of our products under MISSION® Lenti microRNA Inhibitor


Storage Class

12 - Non Combustible Liquids

wgk

WGK 3

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ruben Aquino-Martinez et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(1), 135-144 (2018-10-16)
Developing novel approaches to treat skeletal disorders requires an understanding of how critical molecular factors regulate osteoblast differentiation and bone remodeling. We have reported that (1) retinoic acid receptor-related orphan receptor beta (Rorβ) is upregulated in bone samples isolated from
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of



Global Trade Item Number

SKUGTIN
HLTUD002C04061836743949