Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Segment
product line
MISSION®
form
solid
mature sequence
CAAAGUGCUUACAGUGCAGGUAG
Sanger mature/minor accession no.
microRNA accession no.
MI0000687
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Signal Word
Warning
Hazard Codes
Precautionary Statements
Hazard Classifications
STOT RE 2 Inhalation
Target Organs
Respiratory Tract
Storage Class
11 - Combustible Solids
WGK
WGK 3
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
