Skip to Content
Merck
CN

EHU083111

Sigma-Aldrich

MISSION® esiRNA

targeting human CD86

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGGCTCATGACCTGGAAATAAAATTTAGGACCAATACCTCCTCCAGATCAGATTCTTCTCTTAATTTCATAGATTGTGTTTTTTTTTTAAATAGACCTCTCAATTTCTGGAAAACTGCCTTTTATCTGCCCAGAATTCTAAGCTGGTGCCCCACTGAATTTTGTGTGTACCTGTGACTAAACAACTACCTCCTCAGTCTGGGTGGGACTTATGTATTTATGACCTTATAGTGTTAATATCTTGAAACATAGAGATCTATGTACTGTAATAGTGTGATTACTATGCTCTAGAGAAAAGTCTACCCCTGCTAAGGAGTTCTCATCCCTCTGTCAGGGTCAGTAAGGAAAACGGTGGCCTAGGGTACAGGCAACAATGAGCAGACCAACCTAAATTTGGGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD86(942), CD86(942)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Impacts of CD40- and CD86-Silenced Antigen-Specific B Cells on the Control of Allergies.
Motohiko Suzuki et al.
American journal of rhinology & allergy, 33(5), 513-523 (2019-05-09)
Emi Furusawa et al.
The Journal of investigative dermatology, 139(10), 2164-2173 (2019-04-13)
PD-L2 is a ligand for the immune checkpoint receptor PD-1; however, its regulatory function is unclear. We previously reported that silencing of CD86 in cutaneous dendritic cells by topical application of small interfering RNA (siRNA) inhibits the elicitation of contact
Naila Mebarek et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 92, 216-227 (2015-03-23)
Dendritic cells (DCs) are professional antigen-presenting cells that play a critical role in maintaining the balance between immunity and tolerance and, as such are a promising immunotherapy tool to induce immunity or to restore tolerance. The main challenge to harness

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service