Skip to Content
Merck
CN

EHU146001

MISSION® esiRNA

targeting human P2RX7

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human P2RX7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Ensembl | human accession no.

ENSG00000089041

NCBI accession no.

NM_002562

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... P2RX7(5027), P2RX7(5027)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
WWU
HOU
QCS
VGT

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Valentina Salvestrini et al.
Oncotarget, 8(4), 5895-5908 (2016-12-17)
Recent studies have shown that high ATP levels exhibit direct cytotoxic effects on several cancer cells types. Among the receptors engaged by ATP, P2X7R is the most consistently expressed by tumors. P2X7R is an ATP-gated ion channel that could drive
Miso Park et al.
Scientific reports, 9(1), 11587-11587 (2019-08-14)
Tamoxifen (TAM) is the standard anti-hormonal therapy for estrogen receptor-positive breast cancer. However, long-term TAM therapy can make acquisition of TAM resistance and there are still no solutions to treat TAM-resistant breast cancer. In this study, we found that protein
Bin Leng et al.
Oxidative medicine and cellular longevity, 2020, 5070415-5070415 (2020-10-06)
Vascular endothelial dysfunction is associated with increased mortality in patients with diabetes. Astragaloside IV (As-IV) is a bioactive saponin with therapeutic potential as an anti-inflammatory and antiendothelial dysfunction. However, the underlying mechanism for how As-IV ameliorated endothelial dysfunction is still
Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular
Shu Guan et al.
Frontiers in psychiatry, 10, 770-770 (2019-11-05)
Diabetic neuropathic pain (DNP) and major depressive disorder (MDD) are common complications of diabetes mellitus and mutually affect each other. As a member of the ATP-gated ion channel family, P2X7 receptor is associated with the transduction of pain signal and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service