Merck
CN
Search Within
Document Type

619-80-7

Applied Filters:
Keyword:'619-80-7'
Showing 31-58 of 58 results for "619-80-7" within Technical Documents
Product Information Sheet - CS0660
1. Adams, J., Proteasome inhibition in cancer: development of PS-341., Semin. Oncol. 28, 613- 619 (2001). 2. Berenson, J.R., et al., The role of nuclear factor-κΒ in the biology and treatment
Manganese Superoxide Dismutase (MnSOD) Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA. Requirements, features, and performance of high content
Product Information Sheet
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979) Troubleshooting
Bulletin - NA0200S
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979) Troubleshooting
Bulletin - NA0800
Nucleic Acids Res. 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979). 3. Ausubel
Neurotoxicity and Neurite Outgrowth Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA.Requirements, features, and performance of high content
Product Information Sheet - NA0500
Acids Res., 7, 1513-1522 (1979). 8 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979).
p38 MAP Kinase Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA. Requirements, features, and performance of high content
Bulletin - NA0600
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979).
Brochure: Chromolith® Monolithic Silica HPLC Columns for small and large molecule separation
Gradient: Time Valve A B C 0 1 100 0 0 2 1 100 0 0 2 2 0 80 20 4 2 0 80 20 9 2 0 50 50 9.5 2 0 50 50 9.6 2 0 80 20 15 2 0 80 20 0
Phospho-Histone H3(Ser 10) & Ki-67 Assay
in growth media until ~70-80% confluent. 2. Detach cells from culture flasks/plates via method appropriate for cell type of interest. Adjust cell density to 5-7 x 104 cells/mL in growth media
Manganese Superoxide Dismutase (MnSOD) and Histone H2A.X Phosphorylation Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA.Requirements, features, and performance of high content
Principles of Steam-In-Place
48 76 136 187 305 522 727 1241 2 20 20 38 60 108 148 241 413 575 983 30 30 57 90 162 222 362 619 863 1474 3 20 26 50 79 141 194 316
Imprint Ultra Chromatin Immunoprecipitation Kit User Guide
Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC
Research article: Analytical performance of a commercial multiplex Luminex-based cytokine panel in the rat
619 285 46 Endogenous – 2 88 103 117 Endogenous – 4 141 104 74 IL-12p70a Recombinant 625 2 545 246 45
Evaluation of Intracellular Signaling - Downstream Chimeric Antigen Receptors
xenograft models of adoptive immunotherapy. Cytotherapy. 2014; 16(5):619–30. Epub 2014/01/21. doi: 10.1016/j.jcyt.2013.10.013S1465-3249(13)00759-7 [pii]. PMID: 24439255; PubMed Central PMCID: PMC3988256. 48
3D BIOPRINTING: Printing a Brighter Future
collagenase) 35 30 25 20 15 10 5 0 120 100 80 60 40 20 0 100 80 60 40
3D BIOPRINTING: Printing a Brighter Future
collagenase) 35 30 25 20 15 10 5 0 120 100 80 60 40 20 0 100 80 60 40
MultiScreen® and Millicell® Filter Plates for Assay Development
CV = (SD/mean)*100. 1 2 3 4 A 599 601 649 605 B 509 649 631 598 C 584 607 609 618 D 619 550 605 625 C. Spot number by well location
XP725 Antibody List Lot 129K4831
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
XP725 Antibody List Lot 129K4830
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
XP725 Antibody List Lot 089K4791
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
XP725 Worksheet for Lot Number 071M4826
5 6 Glycogen Synthase Kinase3 GSK3 G6414 615 4 1 5 7 GRANZYME B G1044 616 4 1 5 8 GRANZYME B G1044 617 4 1 6 1 Grb2 G2791 618 4 1 6 2 Grb2 G2791 619 4 1 6 3 GRK2 G7670 620 4
Halal Certificate
that time. Page 54 of 99 Product Name Product Code Halal-ID Product Certificate # 619. ETHYL PYRUVATE, =97%, FG W245735 B75829 HC-22SIA394 620. ETHYL SALICYLATE 99%, FCC, FG W245801
Halal Certificate
that time. Page 54 of 99 Product Name Product Code Halal-ID Product Certificate # 619. ETHYL PYRUVATE, =97%, FG W245735 B75829 HC-23SI6P73 620. ETHYL SALICYLATE 99%, FCC, FG W245801
List of Antibodies
bbc3, C-Terminal P4618 P y y n/d 617 PUMA/bbc3, N-Terminal P4743 P y n/d n/d 618 Pyk2 P3902 P y y y 619 AP2 beta P7114 M y n/d n/d 620 phospho-Pyk2 (pTyr579/580) P6989 P y n/d n/d 621 AP2 alpha P6739 M y
XP725 Antibody List
n/d n/d 618 Pyk2 P3902 50646, 2185, 19229 Ptk2b,PTK2B NP_059014.2,NP_775268.1,NP_766086.1 P y y y 619 phospho-Pyk2 (pTyr579) P7114 50646, 2185 Ptk2b,PTK2B NP_059014.2,NP_775268.1 P y n/d y 620 phospho-
XP725 Antibody List 013M4793
n/d n/d 618 Pyk2 P3902 50646, 2185, 19229 Ptk2b,PTK2B NP_059014.2,NP_775268.1,NP_766086.1 P y y y 619 phospho-Pyk2 (pTyr579) P7114 50646, 2185 Ptk2b,PTK2B NP_059014.2,NP_775268.1 P y n/d y 620 phospho-
Page 2 of 2