Skip to Content
Merck
CN

Skip To

C2432

Sigma-Aldrich

Chloroform

contains 100-200 ppm amylenes as stabilizer, ≥99.5%

Synonym(s):

Methylidyne trichloride, Trichloromethane

Sign Into View Organizational & Contract Pricing

Select a Size

Change View
20 μG
CN¥3,096.05
50 μG
CN¥5,521.21

About This Item

Empirical Formula (Hill Notation):
CHCl3
CAS Number:
Molecular Weight:
119.38
Beilstein:
1731042
EC Number:
MDL number:
UNSPSC Code:
12191502
PubChem Substance ID:
NACRES:
NA.04
Assay:
≥99.5%
Technique(s):
RNA extraction: suitable
Bp:
60.5-61.5 °C (lit.)
Vapor pressure:
160 mmHg ( 20 °C)

CN¥3,096.05


Estimated to ship onNovember 13, 2025Details


Request a Bulk Order
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

vapor density

4.1 (vs air)

Quality Level

vapor pressure

160 mmHg ( 20 °C)

Assay

≥99.5%

form

liquid

contains

100-200 ppm amylenes as stabilizer

technique(s)

RNA extraction: suitable

refractive index

n20/D 1.445 (lit.)

bp

60.5-61.5 °C (lit.)

mp

−63 °C (lit.)

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU166221EMU159761EMU056321
Ensembl | mouse accession no.

ENSMUSG00000027015

Ensembl | mouse accession no.

ENSMUSG00000032058

Ensembl | mouse accession no.

ENSMUSG00000073725

Ensembl | mouse accession no.

ENSMUSG00000024082

esiRNA cDNA target sequence

CAGCCTGGGCAACATAGTGAAACTCTCTTTTGGGATTTTGGTTTCTCTAGTAACCCAAGTTGTCCTCACTCTTTGTGTAATTAAGGGTGACCTTGGACATGTGGTTCTCCTTGTCCTCACTTCCCAAATGCTGCGTTACAGGCATGTGCCACCAGCCACCATGTCTTGGCACAGCTCTGTCTTTTAAATAAAAAATAAAGCCAAACCAAACACATGAATTTTACAGCAAAATACACTTAATATGTTTGGTGTGTAGTGAACTTCCTTTTAGGTAACATGATTATTTCCAAAAGCCAAATACAACCTTCAATCTATCAGATCTCCCAAAGTCCATAACAGCTCAGAATCACTTCAATGCATCATTTCTTGCTTTCCATTAATTAATTCTGTTTCCAAAACCAGTAACAGCATCAGAAGCACTATGAGTGAGGGGCCCAAGATCATTCTTCAGCTAGAGAGTTCAAGACCAGCCTGGGATACATGATACCCTATCTATCTCCGAAGTCCGAT

esiRNA cDNA target sequence

GAGAGACTGTAATTATGAATCAAATCCTGCCCTATATAAAGGAATTAGTGTCTGATACCAACCAACATGTCAAGTCAGCGCTAGCTTCTGTAATTATGGGATTATCTACAGTTTTGGGCAAAGAGAATACCATTGAACATCTTCTGCCTCTATTTTTAGCTCAGTTAAAGGACGAGTGTCCAGAAGTTCGTTTAAATATCATCTCCAATTTGGATTGTGTGAATGAAGTGATTGGAATCCGTCAGCTCTCTCAGTCTCTCCTTCCGGCCATAGTGGAACTGGCTGAAGATGCCAAGTGGAGGGTCCGCCTGGCTATCATTGAGTACATGCCGCTGCTGGCTGGCCAGCTGGGTGTGGAGTTCTTTGATGAAAAACTCAATTCTTTGTGTATGGCCTGGCTTGTGGATCATGTCTATGCCATTCGGGAGGCAGCCACCAACAACCTCATGAAGTTAGTCCAGAAGTTCGGTACAGAGTGGGCCCAGAATACCATTGTCCCTAAAGTGTTGG

esiRNA cDNA target sequence

CTGACTTTGTTCTTGGGAACCAGAATAACTCGTAGAGAATACTCGTAGAATAACATGTAGAGAGTACTAATAGGTGAATTTGCTAATTTGAAGCTATAAACATGTCTACATTGGTTAAGCCTACATAAACTATACTTTTATCAAAGTATCAGGAGGCATATATATCTTTTGAGACTTTTTTTGCTATCTAATAAGTTTAGAAATATCCTAATTATTCTATATACTTACGATAGGATTTTTTTTTGTTAGACCAACTTCTTAGCTTACCATGGTACTCTTTATTGTTTAAACAAGAAAATTTTAAATATATATTTTGCTCCTTTCATTTCCTGAGTGTTAAGAAGCCTACTTTATTCAAATGCTACTTTGTCCCCCTTTTGGTGTAATGAAATGTGTTGGACTTTATATTTCCATAAAGCTGACTTCTAAGTGTCACGACTTCGACTAATGAACAGCTTCTCTCCTTTGAAGTCTTCACAGAAATGCCTAAATTAGAGATCATTCAGAGCATTG

esiRNA cDNA target sequence

GAAAGGAGGGAACATGTGGAAGTATGTCCCGATGCTGGGGTTATCATCCAAGAACTGTCCCAGCGCATTGCGTCAACTGGAGGTGCAGCCCTGATTGCGGATTACGGTCACGATGGCACAAAGACAGACACCTTGAGAGGGTTTTATGGACACCAGCTTCACGATGTCTTAATCGCTCCTGGAACAGCAGACCTGACAGCTGATGTGGACTTCAGTTACCTGCGCAGAATGGCACAAGGAAAAGTAGCCTCTCTGGGTCCAGTGGAACAGCGAACATTTTTAAAAAACATGGGCATTGATGTCCGGCTGAAGGTTCTCTTGGATAAAGCAGGTGAGCCATCTGCGAAGCAGCAGCTACTTGGAGGGTATGATATGTTAATGAATCCTCAGAAGATGGGAGAAAGATTTCACTTCTTTGCCTTGCTACCTCATCAGAGACTTCATGGGGGGAGTCAAGAAAGGAATGCCTGCCAGTCAAAAACCCCCTCCTCCTCTGTA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Gene Information

mouse ... CYBRD1(73649), Cybrd1(73649)

Gene Information

mouse ... PPP2R1B(73699), Ppp2r1b(73699)

Gene Information

mouse ... LMBRD1(68421), Lmbrd1(68421)

Gene Information

mouse ... NDUFAF7(73694), 2410091C18Rik(73694)

NCBI accession no.

NM_028593

NCBI accession no.

NM_028614

NCBI accession no.

NM_026719

NCBI accession no.

NM_028611

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Chloroform is a colorless, volatile chlorinated organic solvent whose vapors have a narcotic effect.[1] The product contains amylene as a stabilizer, since chloroform is susceptible to degradation with time. Amylene acts as a scavenger of free radicals formed during chloroform decomposition.
Our biotech solvents offer exceptional quality for reliable RNA extraction, ensuring optimal laboratory performance. With low water content and minimal residue, give clean UV spectra to minimize contamination.
  • High-Quality Biotech Solvents: Designed for optimal laboratory performance with low water content and minimal residues.
  • Ideal for RNA Extraction: Essential for genetic testing and research applications like PCR.
  • Ensures Integrity of Genetic Material: Promotes reliable and reproducible results.
  • Industry Compliant: Suitable for both academic and commercial laboratories, enhancing research efficiency.

Application

Chloroform has been used for the isolation of RNA from mammalian tissue.[2][3][4]

Pictograms

Skull and crossbonesHealth hazard

Signal Word

Danger

Hazard Classifications

Acute Tox. 3 Inhalation - Acute Tox. 4 Oral - Carc. 2 - Eye Irrit. 2 - Repr. 2 - Skin Irrit. 2 - STOT RE 1 Oral - STOT SE 3

Target Organs

Central nervous system, Liver,Kidney

Storage Class Code

6.1D - Non-combustible acute toxic Cat.3 / toxic hazardous materials or hazardous materials causing chronic effects

WGK

WGK 3

Flash Point(F)

does not flash

Flash Point(C)

does not flash

Regulatory Information

易制毒化学品(2类)
危险化学品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

  1. How does the storage temperature relate to shipping conditions?

    The storage conditions that a Sigma-Aldrich catalog and label recommend for products are deliberately conservative. For many products, long-term storage at low temperatures will increase the time during which they are expected to remain in specification and therefore are labeled accordingly. Where short-term storage, shipping time frame, or exposure to conditions other than those recommended for long-term storage will not affect product quality, Sigma-Aldrich will ship at ambient temperature. The products sensitive to short-term exposure to conditions other than their recommended long-term storage are shipped on wet or dry ice. Ambient temperature shipping helps to control shipping costs for our customers. At any time, our customers can request wet- or dry-ice shipment, but the special handling is at customer expense if our product history indicates that the product is stable for regular shipment. See Shipping and Storage for more information.

  2. Which document(s) contains shelf-life or expiration date information for a given product?

    If available for a given product, the recommended re-test date or the expiration date can be found on the Certificate of Analysis.

  3. How do I get lot-specific information or a Certificate of Analysis?

    The lot specific COA document can be found by entering the lot number above under the "Documents" section.

  4. How do I find price and availability?

    There are several ways to find pricing and availability for our products. Once you log onto our website, you will find the price and availability displayed on the product detail page. You can contact any of our Customer Sales and Service offices to receive a quote.  USA customers:  1-800-325-3010 or view local office numbers.

  5. What is the Department of Transportation shipping information for this product?

    Transportation information can be found in Section 14 of the product's (M)SDS.To access the shipping information for this material, use the link on the product detail page for the product. 

  6. What amount of amylenes are present in Product C2432, Chloroform, as a stabilizer?

    The concentration of amylenes is 100 - 300 ppm.

  7. Has Product C2432, Chloroform, been tested for DNase and RNase activity?

    This product has not been tested for DNase and RNase activity. However, it has been tested and found to be suitable for the extraction of nucleic acids based upon the evaluation of extracted DNA by agarose electrophoresis.

  8. How can Product C2432, Chloroform, be used to extract proteins from nucleic acids?

    A protocol for using phenol:chloroform or phenol:chloroform:isoamyl alcohol to extract proteins from nucleic acids is described in Molecular Cloning: A Laboratory Manual, vol. 3, pp E.3 - E.4 (1989).

  9. My question is not addressed here, how can I contact Technical Service for assistance?

    Ask a Scientist here.

GC-MS-Based Analysis of Chloroform Extracted Suberin-Associated Root Waxes from Arabidopsis and Other Plant Species.
GC-MS-Based Analysis of Chloroform Extracted Suberin-Associated Root Waxes from Arabidopsis and Other Plant Species.
Kosma DK, et al.
Bio-protocol, 5(24) (2015)
Immune activation and target organ damage are consequences of hydrodynamic treatment but not delivery of naked siRNAs in mice.
Racz Z et al.
Nucleic Acid Therapeutics, 21, 215-215 (2011)
Atrial fibrosis in a chronic murine model of obstructive sleep apnea: mechanisms and prevention by mesenchymal stem cells.
Ramos P et al.
Respiratory Research, 15, 54-54 (2014)
RNA Isolation from Synechocystis.
Mironov KS and. Los DA.
Bio-protocol, 5(6) (2015)
Min Wang et al.
Journal of colloid and interface science, 445, 84-92 (2015-01-18)
Phospholipids fulfill an important role in joint lubrication. They, together with hyaluronan and glycoproteins, are the biolubricants that sustain low friction between cartilage surfaces bathed in synovial fluid. In this work we have investigated how the friction force and load

Articles

Substances are said to be miscible in one another if they dissolve to form a uniform solution. Bookmark or download our miscibility table for common lab solvents.

Protocols

Preparation for biodegradable nanoparticles and their use in transfection protocols .

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service