C2432
Chloroform
contains 100-200 ppm amylenes as stabilizer, ≥99.5%
Synonym(s):
Methylidyne trichloride, Trichloromethane
Select a Size
About This Item
vapor density
4.1 (vs air)
Quality Level
vapor pressure
160 mmHg ( 20 °C)
Assay
≥99.5%
form
liquid
contains
100-200 ppm amylenes as stabilizer
technique(s)
RNA extraction: suitable
refractive index
n20/D 1.445 (lit.)
bp
60.5-61.5 °C (lit.)
mp
−63 °C (lit.)
Looking for similar products? Visit Product Comparison Guide
1 of 4
This Item | EMU166221 | EMU159761 | EMU056321 |
---|---|---|---|
Ensembl | mouse accession no. | Ensembl | mouse accession no. | Ensembl | mouse accession no. | Ensembl | mouse accession no. |
esiRNA cDNA target sequence CAGCCTGGGCAACATAGTGAAACTCTCTTTTGGGATTTTGGTTTCTCTAGTAACCCAAGTTGTCCTCACTCTTTGTGTAATTAAGGGTGACCTTGGACATGTGGTTCTCCTTGTCCTCACTTCCCAAATGCTGCGTTACAGGCATGTGCCACCAGCCACCATGTCTTGGCACAGCTCTGTCTTTTAAATAAAAAATAAAGCCAAACCAAACACATGAATTTTACAGCAAAATACACTTAATATGTTTGGTGTGTAGTGAACTTCCTTTTAGGTAACATGATTATTTCCAAAAGCCAAATACAACCTTCAATCTATCAGATCTCCCAAAGTCCATAACAGCTCAGAATCACTTCAATGCATCATTTCTTGCTTTCCATTAATTAATTCTGTTTCCAAAACCAGTAACAGCATCAGAAGCACTATGAGTGAGGGGCCCAAGATCATTCTTCAGCTAGAGAGTTCAAGACCAGCCTGGGATACATGATACCCTATCTATCTCCGAAGTCCGAT | esiRNA cDNA target sequence GAGAGACTGTAATTATGAATCAAATCCTGCCCTATATAAAGGAATTAGTGTCTGATACCAACCAACATGTCAAGTCAGCGCTAGCTTCTGTAATTATGGGATTATCTACAGTTTTGGGCAAAGAGAATACCATTGAACATCTTCTGCCTCTATTTTTAGCTCAGTTAAAGGACGAGTGTCCAGAAGTTCGTTTAAATATCATCTCCAATTTGGATTGTGTGAATGAAGTGATTGGAATCCGTCAGCTCTCTCAGTCTCTCCTTCCGGCCATAGTGGAACTGGCTGAAGATGCCAAGTGGAGGGTCCGCCTGGCTATCATTGAGTACATGCCGCTGCTGGCTGGCCAGCTGGGTGTGGAGTTCTTTGATGAAAAACTCAATTCTTTGTGTATGGCCTGGCTTGTGGATCATGTCTATGCCATTCGGGAGGCAGCCACCAACAACCTCATGAAGTTAGTCCAGAAGTTCGGTACAGAGTGGGCCCAGAATACCATTGTCCCTAAAGTGTTGG | esiRNA cDNA target sequence CTGACTTTGTTCTTGGGAACCAGAATAACTCGTAGAGAATACTCGTAGAATAACATGTAGAGAGTACTAATAGGTGAATTTGCTAATTTGAAGCTATAAACATGTCTACATTGGTTAAGCCTACATAAACTATACTTTTATCAAAGTATCAGGAGGCATATATATCTTTTGAGACTTTTTTTGCTATCTAATAAGTTTAGAAATATCCTAATTATTCTATATACTTACGATAGGATTTTTTTTTGTTAGACCAACTTCTTAGCTTACCATGGTACTCTTTATTGTTTAAACAAGAAAATTTTAAATATATATTTTGCTCCTTTCATTTCCTGAGTGTTAAGAAGCCTACTTTATTCAAATGCTACTTTGTCCCCCTTTTGGTGTAATGAAATGTGTTGGACTTTATATTTCCATAAAGCTGACTTCTAAGTGTCACGACTTCGACTAATGAACAGCTTCTCTCCTTTGAAGTCTTCACAGAAATGCCTAAATTAGAGATCATTCAGAGCATTG | esiRNA cDNA target sequence GAAAGGAGGGAACATGTGGAAGTATGTCCCGATGCTGGGGTTATCATCCAAGAACTGTCCCAGCGCATTGCGTCAACTGGAGGTGCAGCCCTGATTGCGGATTACGGTCACGATGGCACAAAGACAGACACCTTGAGAGGGTTTTATGGACACCAGCTTCACGATGTCTTAATCGCTCCTGGAACAGCAGACCTGACAGCTGATGTGGACTTCAGTTACCTGCGCAGAATGGCACAAGGAAAAGTAGCCTCTCTGGGTCCAGTGGAACAGCGAACATTTTTAAAAAACATGGGCATTGATGTCCGGCTGAAGGTTCTCTTGGATAAAGCAGGTGAGCCATCTGCGAAGCAGCAGCTACTTGGAGGGTATGATATGTTAATGAATCCTCAGAAGATGGGAGAAAGATTTCACTTCTTTGCCTTGCTACCTCATCAGAGACTTCATGGGGGGAGTCAAGAAAGGAATGCCTGCCAGTCAAAAACCCCCTCCTCCTCTGTA |
product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
Gene Information mouse ... CYBRD1(73649), Cybrd1(73649) | Gene Information mouse ... PPP2R1B(73699), Ppp2r1b(73699) | Gene Information mouse ... LMBRD1(68421), Lmbrd1(68421) | Gene Information mouse ... NDUFAF7(73694), 2410091C18Rik(73694) |
NCBI accession no. | NCBI accession no. | NCBI accession no. | NCBI accession no. |
storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
General description
- High-Quality Biotech Solvents: Designed for optimal laboratory performance with low water content and minimal residues.
- Ideal for RNA Extraction: Essential for genetic testing and research applications like PCR.
- Ensures Integrity of Genetic Material: Promotes reliable and reproducible results.
- Industry Compliant: Suitable for both academic and commercial laboratories, enhancing research efficiency.
Signal Word
Danger
Hazard Statements
Precautionary Statements
Hazard Classifications
Acute Tox. 3 Inhalation - Acute Tox. 4 Oral - Carc. 2 - Eye Irrit. 2 - Repr. 2 - Skin Irrit. 2 - STOT RE 1 Oral - STOT SE 3
Target Organs
Central nervous system, Liver,Kidney
Storage Class Code
6.1D - Non-combustible acute toxic Cat.3 / toxic hazardous materials or hazardous materials causing chronic effects
WGK
WGK 3
Flash Point(F)
does not flash
Flash Point(C)
does not flash
Regulatory Information
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
How does the storage temperature relate to shipping conditions?
The storage conditions that a Sigma-Aldrich catalog and label recommend for products are deliberately conservative. For many products, long-term storage at low temperatures will increase the time during which they are expected to remain in specification and therefore are labeled accordingly. Where short-term storage, shipping time frame, or exposure to conditions other than those recommended for long-term storage will not affect product quality, Sigma-Aldrich will ship at ambient temperature. The products sensitive to short-term exposure to conditions other than their recommended long-term storage are shipped on wet or dry ice. Ambient temperature shipping helps to control shipping costs for our customers. At any time, our customers can request wet- or dry-ice shipment, but the special handling is at customer expense if our product history indicates that the product is stable for regular shipment. See Shipping and Storage for more information.
Which document(s) contains shelf-life or expiration date information for a given product?
If available for a given product, the recommended re-test date or the expiration date can be found on the Certificate of Analysis.
How do I get lot-specific information or a Certificate of Analysis?
The lot specific COA document can be found by entering the lot number above under the "Documents" section.
How do I find price and availability?
There are several ways to find pricing and availability for our products. Once you log onto our website, you will find the price and availability displayed on the product detail page. You can contact any of our Customer Sales and Service offices to receive a quote. USA customers: 1-800-325-3010 or view local office numbers.
What is the Department of Transportation shipping information for this product?
Transportation information can be found in Section 14 of the product's (M)SDS.To access the shipping information for this material, use the link on the product detail page for the product.
What amount of amylenes are present in Product C2432, Chloroform, as a stabilizer?
The concentration of amylenes is 100 - 300 ppm.
Has Product C2432, Chloroform, been tested for DNase and RNase activity?
This product has not been tested for DNase and RNase activity. However, it has been tested and found to be suitable for the extraction of nucleic acids based upon the evaluation of extracted DNA by agarose electrophoresis.
How can Product C2432, Chloroform, be used to extract proteins from nucleic acids?
A protocol for using phenol:chloroform or phenol:chloroform:isoamyl alcohol to extract proteins from nucleic acids is described in Molecular Cloning: A Laboratory Manual, vol. 3, pp E.3 - E.4 (1989).
My question is not addressed here, how can I contact Technical Service for assistance?
Ask a Scientist here.
GC-MS-Based Analysis of Chloroform Extracted Suberin-Associated Root Waxes from Arabidopsis and Other Plant Species.
Articles
Substances are said to be miscible in one another if they dissolve to form a uniform solution. Bookmark or download our miscibility table for common lab solvents.
Protocols
Preparation for biodegradable nanoparticles and their use in transfection protocols .
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service