Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SNAI1(6615)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Elsa M Reyes-Reyes et al.
Oncotarget, 8(61), 103828-103842 (2017-12-22)
Although several lines of evidence have established the central role of epithelial-to-mesenchymal-transition (EMT) in malignant progression of non-small cell lung cancers (NSCLCs), the molecular events connecting EMT to malignancy remain poorly understood. This study presents evidence that Long Interspersed Nuclear
Yun Zhan et al.
Oncotarget, 8(3), 4629-4641 (2016-11-29)
Metastasis is a multi-step process. Tumor cells occur epithelial-mesenchymal transition (EMT) to start metastasis, then, they need to undergo a reverse progression of EMT, mesenchymal-epithelial transition (MET), to colonize and form macrometastases at distant organs to complete the whole process
Yu-Yi Liu et al.
Scientific reports, 7(1), 2461-2461 (2017-05-28)
We previously performed long non-coding RNA (lncRNA) expression microarray analyses to identify novel indicators for gastric cancer (GC) metastasis and prognosis in which we identified lncRNA XLOC_010235 (XLOC) as a candidate RNA. However, XLOC_010235 molecular mechanism of action remains unclear.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU030431-50UG | 04061828344161 |
| EHU030431-20UG | 04061831350654 |