Skip to Content
Merck
CN

EHU034121

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCG

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT

Ensembl | human accession no.

ENSG00000126583

NCBI accession no.

NM_002739

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKCG(5582), PRKCG(5582)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
NRR
RPR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Ke Wu et al.
Antioxidants & redox signaling, 30(17), 1983-1998 (2018-05-29)
Aims: Epidemiologic evidence indicates that diabetes may increase risk of breast cancer (BC) and mortality in patients with cancer.
Mi Yeong Kim et al.
Scientific reports, 9(1), 7044-7044 (2019-05-09)
c-Fms is the macrophage colony-stimulating factor (M-CSF) receptor, and intracellular signalling via the M-CSF/c-Fms axis mediates both innate immunity and bone remodelling. M-CSF-induced transient proteolytic degradation of c-Fms modulates various biological functions, and protein kinase C (PKC) signalling is activated
Sylvain Carras et al.
Journal of leukocyte biology, 99(2), 311-319 (2015-09-04)
M-CSF and G-CSF are instructive cytokines that specifically induce differentiation of bipotent myeloid progenitors into macrophages and granulocytes, respectively. Through morphology and colony assay studies, flow cytometry analysis of specific markers, and expression of myeloid transcription factors, we show here
Xiao Li et al.
Antioxidants & redox signaling, 30(9), 1162-1185 (2018-02-28)
Diabetic nephropathy (DN) is the most common microvascular complications and the principal cause of mortality and morbidity rates in patients with diabetes. The expression of advanced oxidation protein products (AOPPs) has been found in vacuolated renal tubules in DN and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service