Skip to Content
Merck
CN

EHU034841

MISSION® esiRNA

targeting human FDXR

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGATTTCTTGGGTCTCCAGGACAAGATCAAGGAGGTCCCCCGCCCGAGGAAGCGGCTGACGGAACTGCTGCTTCGAACGGCCACAGAGAAGCCAGGGCCGGCGGAAGCTGCCCGCCAGGCATCGGCCTCCCGTGCCTGGGGCCTCCGCTTTTTCCGAAGCCCCCAGCAGGTGCTGCCCTCACCAGATGGGCGGCGGGCAGCAGGTGTCCGCCTAGCAGTCACTAGACTGGAGGGTGTCGATGAGGCCACCCGTGCAGTGCCCACGGGAGACATGGAAGACCTCCCTTGTGGGCTGGTGCTCAGCAGCATTGGGTATAAGAGCCGCCCTGTCGACCCAAGCGTGCCCTTTGACTCCAAGCTTGGGGTCATCCCCAATGTGGAGGGCCGGGTTATGGATGTGCCAGGCCTCTACTGCAGCGGCTGGGTGAAGAGAGGACCTACAGGTGTCATAGCCACAACCATGACTGACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FDXR(2232)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S H Akter et al.
Veterinary pathology, 52(6), 1027-1033 (2015-03-11)
Controversies remain regarding the cell type from which human prostate cancer originates, and many attempts have been made to identify the cellular origin of canine prostate cancer but without definitive proof. This study aims to evaluate the expression of luminal
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Fan Sun et al.
Journal of cellular physiology, 230(11), 2640-2646 (2015-02-03)
Adrenoreceptors (ARs) are widely expressed and play essential roles throughout the body. Different subtype adrenoceptors elicit distinct effects on cell proliferation, but knowledge remains scarce about the subtype-specific effects of β2-ARs on the proliferation of embryonic pluripotent stem (PS) cells

Global Trade Item Number

SKUGTIN
EHU034841-50UG04061828310203
EHU034841-20UG04061828545575

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service