Skip to Content
Merck
CN

EHU038231

MISSION® esiRNA

targeting human TNFAIP6

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | human accession no.

ENSG00000123610

NCBI accession no.

NM_007115

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xifeng Li et al.
Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association, 29(12), 104986-104986 (2020-09-30)
Early brain injury (EBI) refers to acute brain injury during the first 72 h after subarachnoid hemorrhage (SAH), which is one of the major causes of poor prognosis after SAH. Here, we investigated the effect and the related mechanism of
Young In Yun et al.
Cytotherapy, 19(1), 28-35 (2016-11-15)
Mesenchymal stromal cells (MSCs) offer tremendous potential for therapeutic applications for inflammatory diseases. However, tissue-derived MSCs, such as bone marrow-derived MSCs (BM-MSCs), have considerable donor variations and limited expandability. It was recently demonstrated that MSCs derived from induced pluripotent stem
Ju-Hyun An et al.
PloS one, 15(2), e0220756-e0220756 (2020-02-11)
Adipose tissue derived mesenchymal stem/stromal cell (ASC)-derived extracellular vesicles (EV) have been reported to be beneficial against dextran sulfate sodium (DSS)-induced colitis in mice. However, the underlying mechanisms have not been fully elucidated. We hypothesize that the tumor necrosis factor-α-stimulated
Hyun Beom Song et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 26(1), 162-172 (2018-01-05)
The cornea is a transparent tissue devoid of blood and lymphatic vessels. However, various inflammatory conditions can cause hemangiogenesis and lymphangiogenesis in the cornea, compromising transparency and visual acuity. Mesenchymal stem/stromal cells (MSCs) have therapeutic potentials in a variety of
Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service