Skip to Content
Merck
CN

EHU038231

MISSION® esiRNA

targeting human TNFAIP6

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | human accession no.

ENSG00000123610

NCBI accession no.

NM_007115

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guohu Di et al.
Investigative ophthalmology & visual science, 58(10), 4344–4354-4344–4354 (2017-08-16)
To explore the role and mechanism of bone marrow-derived mesenchymal stem cells (BM-MSCs) in corneal epithelial wound healing in type 1 diabetic mice. Diabetic mice were treated with subconjunctival injections of BM-MSCs or recombinant tumor necrosis factor-α-stimulated gene/protein-6 (TSG-6). The
Tae-Hoon Shin et al.
Cell death & disease, 7(12), e2524-e2524 (2016-12-23)
Rheumatoid arthritis (RA) is a long-lasting intractable autoimmune disorder, which has become a substantial public health problem. Despite widespread use of biologic drugs, there have been uncertainties in efficacy and long-term safety. Mesenchymal stem cells (MSCs) have been suggested as
Xiangwen Zhang et al.
Tissue & cell, 68, 101455-101455 (2020-11-23)
TNFα-stimulated gene-6 (TNFAIP6) plays an important role in the prognosis of many tumors. Our objective was to investigate the clinical and prognostic value of TNFAIP6 expression in gastric cancer (GC) patients. Here, we investigated the expression of TNFAIP6 in GC
Xifeng Li et al.
Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association, 29(12), 104986-104986 (2020-09-30)
Early brain injury (EBI) refers to acute brain injury during the first 72 h after subarachnoid hemorrhage (SAH), which is one of the major causes of poor prognosis after SAH. Here, we investigated the effect and the related mechanism of
Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service