Skip to Content
Merck
CN

EHU042681

MISSION® esiRNA

targeting human IREB2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human IREB2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCTTGCTGCAGGTCTTTTGGCTAAAAAGGCTGTTGAAGCTGGTCTGCGTGTTAAACCTTATATAAGAACAAGTTTATCTCCAGGCAGTGGGATGGTTACACATTACCTCAGTTCAAGTGGAGTATTACCATATCTAAGTAAGCTTGGATTTGAAATCGTTGGCTATGGATGTTCAATTTGTGTGGGAAATACAGCACCCTTATCAGACGCAGTTTTAAATGCAGTAAAACAGGGTGATTTGGTTACCTGTGGAATTTTATCTGGAAACAAAAATTTTGAAGGTCGTCTTTGTGATTGTGTTCGTGCCAATTATCTTGCCTCTCCACCCTTAGTGGTAGCTTATGCCATAGCAGGCACAGTGAATATAGATTTCCAGACAGAACCTTTAGGTACTGACCCCACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fei Liu et al.
Cancer management and research, 11, 10891-10900 (2020-01-11)
Clear cell renal cell carcinoma (ccRCC) has the highest rate of metastasis and invasion in RCC and is the third most common adult urinary malignancy. miRNA may serve a critical role in human cancer development and progression, has been confirmed
Jin Zhang et al.
The Journal of pathology, 251(3), 284-296 (2020-04-19)
Ferredoxin reductase (FDXR) is a mitochondrial flavoprotein that initiates electron transport from NADPH to several cytochromes P450 via two electron carriers, ferredoxin 1 (FDX1) and FDX2. FDXR is the sole ferredoxin reductase in humans and plays a critical role in
Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Toshifumi Hoki et al.
Hepatology (Baltimore, Md.), 62(3), 751-761 (2015-03-11)
Increased hepatic iron accumulation is thought to be involved in the pathogenesis of nonalcoholic steatohepatitis (NASH). Hepatic iron accumulation, as well as oxidative DNA damage, is significantly increased in NASH livers. However, the precise mechanism of iron accumulation in the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service