Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGCTTGCTGCAGGTCTTTTGGCTAAAAAGGCTGTTGAAGCTGGTCTGCGTGTTAAACCTTATATAAGAACAAGTTTATCTCCAGGCAGTGGGATGGTTACACATTACCTCAGTTCAAGTGGAGTATTACCATATCTAAGTAAGCTTGGATTTGAAATCGTTGGCTATGGATGTTCAATTTGTGTGGGAAATACAGCACCCTTATCAGACGCAGTTTTAAATGCAGTAAAACAGGGTGATTTGGTTACCTGTGGAATTTTATCTGGAAACAAAAATTTTGAAGGTCGTCTTTGTGATTGTGTTCGTGCCAATTATCTTGCCTCTCCACCCTTAGTGGTAGCTTATGCCATAGCAGGCACAGTGAATATAGATTTCCAGACAGAACCTTTAGGTACTGACCCCACCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IREB2(3658)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fei Liu et al.
Cancer management and research, 11, 10891-10900 (2020-01-11)
Clear cell renal cell carcinoma (ccRCC) has the highest rate of metastasis and invasion in RCC and is the third most common adult urinary malignancy. miRNA may serve a critical role in human cancer development and progression, has been confirmed
Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Jin Zhang et al.
The Journal of pathology, 251(3), 284-296 (2020-04-19)
Ferredoxin reductase (FDXR) is a mitochondrial flavoprotein that initiates electron transport from NADPH to several cytochromes P450 via two electron carriers, ferredoxin 1 (FDX1) and FDX2. FDXR is the sole ferredoxin reductase in humans and plays a critical role in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU042681-50UG | 04061828302161 |
| EHU042681-20UG | 04061828550227 |