Skip to Content
Merck
CN

EHU046331

MISSION® esiRNA

targeting human AQP5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGACCAGTGTCAGGCAGGGGCCAGCCCCTCAGCCCCTGAGCCAAGGGGGAAAAGAAGAAAAAGTACCTAACACAAGCTTCCTTTTTGCACAACCGGTCCTCTTGGCTGAGGAGGAGGAGCTGGTCACCCTGGCTGCACAGTTAGAGAGGGGAGAAGGAACCCATGATGGGACTCCTGGGGTAGGGGCCAGGGGCTGGGGTCTGCTGGGGACAGGTCTCTCTGGGACAGACCTCAGAGATTGTGAATGCAGTGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michihiro Kudou et al.
International journal of oncology, 50(5), 1857-1867 (2017-03-31)
Previous studies described that the expression of aquaporin 5 (AQP5) was altered in tumors of various organs. AQP5 is attracting attention as a new cancer therapeutic target. In the present study, heat shock-induced changes in AQP5 expression were evaluated by
Chen Chen et al.
Molecular carcinogenesis, 56(12), 2692-2705 (2017-08-24)
Epithelial-mesenchymal transition (EMT) has emerged as an important determinant role in colorectal cancer (CRC) metastasis. It has been reported that aquaporin 5 (AQP5) is closely linked to CRC metastasis. However, the effect of AQP5 on the EMT process of CRC
Xueqing Li et al.
OncoTargets and therapy, 11, 3359-3368 (2018-06-21)
Based on the functionality of AQP-5 characterized in various physiological processes, our study aimed to investigate the effect of AQP-5 silencing by siRNA interference on chemosensitivity of breast cancer cells. The expression levels of AQP-5 mRNA in different experimental groups
ChunXiao Yan et al.
Journal of ovarian research, 7, 78-78 (2014-10-10)
Recent studies suggested that aquaporins 5 (AQP5) was associated with many kinds of cancers and regulated many processes of various kinds of cancer cells. Our previous studies also demonstrated that AQP5 was highly expressed in epithelial ovarian cancer and contributed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service