Skip to Content
Merck
CN

EHU049181

MISSION® esiRNA

targeting human ZHX1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAACCAGACCGTGAAGAAATTGTAGAAAATCCAAGTTCTTCAGCTTCTGAATCTAATACAAGTACTTCCATTGTAAACAGAATACATCCAAGTACTGCCAGCACGGTAGTGACACCAGCAGCAGTTCTTCCTGGATTGGCACAGGTGATAACTGCTGTATCTGCTCAGCAGAATTCTAATTTGATTCCCAAAGTCTTAATCCCTGTTAATAGCATTCCCACCTACAATGCTGCATTGGATAACAATCCCCTTTTACTTAACACCTACAACAAGTTCCCTTACCCAACAATGTCAGAAATTACAGTTCTTTCTGCTCAAGCAAAATATACAGAGGAACAGATCAAGATATGGTTTTCAGCCCAACGTTTAAAACATGGTGTTAGTTGGACTCCCGAGGAAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ryuk-Jun Kwon et al.
PloS one, 11(11), e0165516-e0165516 (2016-11-12)
Zinc-fingers and homeoboxes 1 (ZHX1) is a transcription repressor that has been associated with the progressions of hepatocellular carcinoma, gastric cancer, and breast cancer. However, the functional roles of ZHX1 in cholangiocarcinoma (CCA) have not been determined. We investigated the
Jinping Guan et al.
American journal of translational research, 9(5), 2457-2465 (2017-06-01)
MicroRNAs play an important role in cell proliferation, apoptosis, differentiation, and invasion by regulating the expression of various genes. For example, the downregulation of microRNA-199a-3p (miR-199a-3p) that is noted in numerous human malignancies, including hepatocellular carcinoma (HCC), results in a
Yi-Kai Pan et al.
Apoptosis : an international journal on programmed cell death, 25(1-2), 73-91 (2019-11-27)
Weightlessness-induced cardiovascular dysfunction can lead to physiological and pathological consequences. It has been shown that spaceflight or simulated microgravity can alter expression profiles of some microRNAs (miRNAs). Here, we attempt to identify the role of miRNAs in human umbilical vein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service