Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TGFBR1(7046)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Weitang Liao et al.
Frontiers in physiology, 11, 1093-1093 (2020-10-06)
Renal tubulointerstitial fibrosis is usually the final outcome of various end-stage renal diseases. Recent studies have reported that microRNAs (miRNAs) play an important role in renal fibrosis. However, the biological function of microRNAs in renal fibrosis is complicated and remains
Hilène Lin et al.
Scientific reports, 8(1), 10488-10488 (2018-07-12)
Cartilage loss in osteoarthritis (OA) results from altered local production of growth factors and metalloproteases (MMPs). Furin, an enzyme involved in the protein maturation of MMPs, might regulate chondrocyte function. Here, we tested the effect of furin on chondrocyte catabolism
Teppei Sugano et al.
British journal of cancer, 124(1), 228-236 (2020-11-28)
Metastasis is the primary cause of death in cancer patients, and its management is still a major challenge. Epithelial to mesenchymal transition (EMT) has been implicated in the process of cancer metastasis, and its pharmacological interference holds therapeutic promise. Traf2-
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU051131-20UG | 04061831343649 |
| EHU051131-50UG | 04061831371918 |