Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCTCTCAACTTCTCCTTGGACCCCCAAGCCCCAGTGGACAGCCACGGCCTCAGGCCAGCCCTACATTATCAGAGCAAGAGCCGGATAGAGGACAAGGCTCAGATCTTGCTGGACTGTGGAGAAGACAACATCTGTGTGCCTGACCTGCAGCTGGAAGTGTTTGGGGAGCAGAACCATGTGTACCTGGGTGACAAGAATGCCCTGAACCTCACTTTCCATGCCCAGAATGTGGGTGAGGGTGGCGCCTATGAGGCTGAGCTTCGGGTCACCGCCCCTCCAGAGGCTGAGTACTCAGGACTCGTCAGACACCCAGGGAACTTCTCCAGCCTGAGCTGTGACTACTTTGCCGTGAACCAGAGCCGCCTGCTGGTGTGTGACCTGGGCAACCCCATGAAGGCAGGAGCCAGTCTGTGGGGTGGCCTTCGGTTTACAGTCCCTCATCTCCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGA5(3678)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Oded Komemi et al.
International journal of cancer, 144(7), 1633-1644 (2018-09-09)
The extracellular matrix (ECM) affects cancer cell characteristics. Inability of normal epithelial cells to attach to the ECM induces apoptosis (anoikis). Cancer cells are often anoikis resistant, a prerequisite for their metastatic spread. Previously we demonstrated that the placenta manipulates
Hao Liu et al.
Therapeutic advances in chronic disease, 11, 2040622320912661-2040622320912661 (2020-04-29)
D-mannose exhibits strong anti-inflammatory properties, but whether it has beneficial effects on preventing and treating osteoporosis remains unknown. Female, 12-month-old senile C57BL6/J mice (s-Man group) and 8-week-old ovariectomized C57BL6/J mice (OVX-Man group) were treated with D-mannose in drinking water for
Carola Parolin et al.
Frontiers in microbiology, 9, 2630-2630 (2018-11-22)
Lactobacilli play a crucial role in maintaining the ecological equilibrium of the vaginal niche, preventing the colonization of exogenous microorganisms. Although many studies have discussed the mechanisms displayed by lactobacilli in counteracting several urogenital pathogens, a few data are available
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU055731-20UG | 04061831344233 |
| EHU055731-50UG | 04061828324569 |