Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAAAGATCCCCATCAAACGCTCAGACATGCTGAGGGATGTCATCCAAGAATATGATGAATATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAGCAAAGTAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCAGGCATACTGGGAACGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAATGGCAACAAGGCCAGTGAGGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGGTGAGGCATTCACTCTTTGGGGAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTACCTGGAGTACAAGAGGGTCCCTAACAGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRO(7216)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guoshuai Cao et al.
Cancer communications (London, England), 41(1), 51-61 (2021-07-09)
The interaction between activating receptor NKp30 and its major tumor ligand B7-H6 is important for NK cell-mediated tumor rejection. However, the regulation of B7-H6 by tumor therapeutics remains largely unknown. In this study, we investigated the regulation of B7-H6 by
Min Young Ahn et al.
Journal of vascular research, 55(2), 75-86 (2018-02-07)
Thrombospondin-1 (TSP-1) is implicated in vascular diseases associated with oxidative stress, such as abdominal aortic aneurysms, ischemia-reperfusion injury, and atherosclerosis. However, the regulatory mechanisms underlying TSP-1 expression are not fully elucidated. In this study, we found that peroxisome proliferator-activated receptor
Hongyong Fu et al.
Molecular therapy. Nucleic acids, 12, 769-786 (2018-08-25)
Spermatogonial stem cells (SSCs) have significant applications in reproductive and regenerative medicine. However, nothing is known about genes in mediating human SSCs. Here we have explored for the first time the function and mechanism of P21-activated kinase 1 (PAK1) in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065101-50UG | 04061828382729 |
| EHU065101-20UG | 04061828615513 |