Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTTTTCAGGAGCTCTGGTGAAGTGGGTGGAGCATCAGCGTTTGCTCAGTTAAGGGAGAGGTAGAGAGGGGCCCGTGAAGTCCTTTGTCACTTCTCTTGCCTTAGTGTGCCTCCCAATACTCCCTTCTTCCTGCCCCCACACCCCATCCCCAGCTAGCCCAAGCTCCAGGTCAGGAGGGGAGGGTGCTGGGCCTGACATGGCTATATACCCTCCCAGGAGTAAAAGCCAAGCAAGAGGTTGTTTTTGCCAAGAATCACAGAATGTTAGAGCTGACAGGACCCTTGAAGGTCACTTAGCCTTCTTAGGCAAACGCCTGCAAAACAGAAGCCTGGAGAGGGGAGTGACCTGCTCAGAGTCATTGCAGAGCCGGGATGGGGACCAGGTCTCCCATCTCCTACTTTATGACGCC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... APLN(8862)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yoko Yokoyama et al.
Arthritis & rheumatology (Hoboken, N.J.), 70(10), 1661-1672 (2018-04-21)
Apelin/APJ signaling has been determined to regulate cardiac and arterial fibrosis and to be involved in the pathogenesis of pulmonary arterial hypertension. Our objective was to elucidate the role of apelin in skin fibrosis in systemic sclerosis (SSc). Expression of
Yu-Han Wang et al.
Cells, 9(3) (2020-03-07)
Synovium-induced angiogenesis is central to osteoarthritis (OA) pathogenesis and thus a promising therapeutic target. The adipokine apelin (APLN) is involved in both OA pathogenesis and angiogenesis. We examined the role of APLN in synovium-induced angiogenesis by investigating the crosstalk between
Aung Than et al.
The Journal of biological chemistry, 290(23), 14679-14691 (2015-05-02)
Brown adipose tissue expends energy in the form of heat via the mitochondrial uncoupling protein UCP1. Recent studies showed that brown adipose tissue is present in adult humans and may be exploited for its anti-obesity and anti-diabetes actions. Apelin is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU071861-20UG | 04061828611386 |
| EHU071861-50UG | 04061828371761 |