Skip to Content
Merck
CN

EHU071861

MISSION® esiRNA

targeting human APLN

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTTTCAGGAGCTCTGGTGAAGTGGGTGGAGCATCAGCGTTTGCTCAGTTAAGGGAGAGGTAGAGAGGGGCCCGTGAAGTCCTTTGTCACTTCTCTTGCCTTAGTGTGCCTCCCAATACTCCCTTCTTCCTGCCCCCACACCCCATCCCCAGCTAGCCCAAGCTCCAGGTCAGGAGGGGAGGGTGCTGGGCCTGACATGGCTATATACCCTCCCAGGAGTAAAAGCCAAGCAAGAGGTTGTTTTTGCCAAGAATCACAGAATGTTAGAGCTGACAGGACCCTTGAAGGTCACTTAGCCTTCTTAGGCAAACGCCTGCAAAACAGAAGCCTGGAGAGGGGAGTGACCTGCTCAGAGTCATTGCAGAGCCGGGATGGGGACCAGGTCTCCCATCTCCTACTTTATGACGCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoko Yokoyama et al.
Arthritis & rheumatology (Hoboken, N.J.), 70(10), 1661-1672 (2018-04-21)
Apelin/APJ signaling has been determined to regulate cardiac and arterial fibrosis and to be involved in the pathogenesis of pulmonary arterial hypertension. Our objective was to elucidate the role of apelin in skin fibrosis in systemic sclerosis (SSc). Expression of
Yu-Han Wang et al.
Cells, 9(3) (2020-03-07)
Synovium-induced angiogenesis is central to osteoarthritis (OA) pathogenesis and thus a promising therapeutic target. The adipokine apelin (APLN) is involved in both OA pathogenesis and angiogenesis. We examined the role of APLN in synovium-induced angiogenesis by investigating the crosstalk between
Aung Than et al.
The Journal of biological chemistry, 290(23), 14679-14691 (2015-05-02)
Brown adipose tissue expends energy in the form of heat via the mitochondrial uncoupling protein UCP1. Recent studies showed that brown adipose tissue is present in adult humans and may be exploited for its anti-obesity and anti-diabetes actions. Apelin is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service