Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCACCCTCAATGAGATGTTCCGCGAGGTTGAGGAACTGATGGAGGACACGCAGCACAAATTGCGCAGCGCGGTGGAAGAGATGGAGGCAGAAGAAGCTGCTGCTAAAGCATCATCAGAAGTGAACCTGGCAAACTTACCTCCCAGCTATCACAATGAGACCAACACAGACACGAAGGTTGGAAATAATACCATCCATGTGCACCGAGAAATTCACAAGATAACCAACAACCAGACTGGACAAATGGTCTTTTCAGAGACAGTTATCACATCTGTGGGAGACGAAGAAGGCAGAAGGAGCCACGAGTGCATCATCGACGAGGACTGTGGGCCCAGCATGTACTGCCAGTTTGCCAGCTTCCAGTACACCTGCCAGCCATGCCGGGGCCAGAGGATGCTCTGCACCCGGGACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DKK3(27122)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Bo Liu et al.
Experimental and therapeutic medicine, 18(6), 4747-4757 (2019-11-28)
MicroRNA-1303 (miR-1303) is involved in the tumorigenesis and progression of several cancers, and yet the role of miR-1303 in prostate cancer (PCa) and its underlying mechanism are unknown. To explore this issue, the present study aimed to use PCa tissues
Zainab Al Shareef et al.
Oncogene, 37(39), 5305-5324 (2018-06-03)
Aberrant transforming growth factor-β (TGF-β) signaling is a hallmark of the stromal microenvironment in cancer. Dickkopf-3 (Dkk-3), shown to inhibit TGF-β signaling, is downregulated in prostate cancer and upregulated in the stroma in benign prostatic hyperplasia, but the function of
Gang Peng et al.
Experimental and therapeutic medicine, 18(1), 769-778 (2019-07-02)
MicroRNAs (miRs) serve important roles in glioma. However, the underlying molecular mechanism of miR-25 in glioma progression remains largely unknown; therefore, it was investigated in the present study. RT-qPCR analysis revealed that miR-25 expression levels were markedly increased in human
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU072211-20UG | 04061831352658 |
| EHU072211-50UG | 04061828372096 |