Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TJP1(7082)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Alan S Fanning et al.
Molecular biology of the cell, 23(4), 577-590 (2011-12-23)
The structure and function of both adherens (AJ) and tight (TJ) junctions are dependent on the cortical actin cytoskeleton. The zonula occludens (ZO)-1 and -2 proteins have context-dependent interactions with both junction types and bind directly to F-actin and other
Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078241-50UG | 04061828401710 |
| EHU078241-20UG | 04061828629282 |