Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTCATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTTTTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTATTATCTCCTGTCTGGGGCTGGAGAGCACCTGAAGACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MYH9(4627)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Satyendra Kumar Singh et al.
Medical oncology (Northwood, London, England), 37(10), 88-88 (2020-09-10)
Non-muscle myosin IIA heavy chain (MYH9) has been implicated in many physiological and pathological functions including cell adhesion, polarity, motility to cancer. However, its role in melanoma remains unexplored. The aim of our study was to evaluate the role of
Shuli Liang et al.
PloS one, 6(4), e18409-e18409 (2011-05-03)
MicroRNAs (miRNAs) are important regulators that play key roles in tumorigenesis and tumor progression. A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. Through miRNA array, we found that let-7f was downregulated
Bo Yang et al.
Nature materials, 19(2), 239-250 (2019-10-30)
A common feature of cancer cells is the alteration of kinases and biochemical signalling pathways enabling transformed growth on soft matrices, whereas cytoskeletal protein alterations are thought to be a secondary issue. However, we report here that cancer cells from
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081611-20UG | 04061828632015 |
| EHU081611-50UG | 04061831373462 |