Skip to Content
Merck
CN

EHU081611

MISSION® esiRNA

targeting human MYH9

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human MYH9

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTCATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTTTTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTATTATCTCCTGTCTGGGGCTGGAGAGCACCTGAAGACC

Ensembl | human accession no.

ENSG00000100345

NCBI accession no.

NM_002473

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... MYH9(4627), MYH9(4627)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
QCS
IET
YZS
DOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Yang et al.
Nature materials, 19(2), 239-250 (2019-10-30)
A common feature of cancer cells is the alteration of kinases and biochemical signalling pathways enabling transformed growth on soft matrices, whereas cytoskeletal protein alterations are thought to be a secondary issue. However, we report here that cancer cells from
Satyendra Kumar Singh et al.
Medical oncology (Northwood, London, England), 37(10), 88-88 (2020-09-10)
Non-muscle myosin IIA heavy chain (MYH9) has been implicated in many physiological and pathological functions including cell adhesion, polarity, motility to cancer. However, its role in melanoma remains unexplored. The aim of our study was to evaluate the role of
Shuli Liang et al.
PloS one, 6(4), e18409-e18409 (2011-05-03)
MicroRNAs (miRNAs) are important regulators that play key roles in tumorigenesis and tumor progression. A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. Through miRNA array, we found that let-7f was downregulated
Jeong Suk Kang et al.
Scientific reports, 9(1), 7679-7679 (2019-05-24)
MYH9, a widely expressed gene encoding nonmuscle myosin heavy chain, is also expressed in podocytes and is associated with glomerular pathophysiology. However, the mechanisms underlying MYH9-related glomerular diseases associated with proteinuria are poorly understood. Therefore, we investigated the role and
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service