Skip to Content
Merck
CN

EHU083631

Sigma-Aldrich

MISSION® esiRNA

targeting human PBX3

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCTCTGGAGGTTCTTCAGATAACTCTATTGAACACTCAGATTACAGAGCCAAATTGACCCAGATCAGACAAATCTATCACACAGAACTGGAGAAATATGAACAGGCATGTAATGAATTTACTACACATGTGATGAACCTTCTCCGAGAACAGAGTAGAACACGTCCCATTTCTCCAAAAGAGATTGAAAGAATGGTGGGCATCATCCATCGAAAATTTAGTTCCATTCAGATGCAGCTCAAACAAAGCACTTGTGAAGCAGTTATGATTTTAAGATCAAGGTTCCTTGATGCCAGACGGAAAAGGCGTAACTTCAGTAAACAGGCCACAGAAATCTTGAATGAATATTTTTACTCACACCTCAGCAACCCCTACCCCAGTGAAGAAGCCAAAGAGGAGC

Ensembl | human accession no.

ENSG00000167081

NCBI accession no.

NM_006195

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PBX3(5090), PBX3(5090)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
QCS
DOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhuochao Zhang et al.
Cancer letters, 397, 33-42 (2017-03-16)
Cancer-associated fibroblasts (CAFs) play a pivotal role in regulating tumour progression. Therefore, understanding how CAFs communicate with hepatocellular carcinoma (HCC) is crucial for HCC therapy. Recently, exosomes have been considered an important "messenger" between cells. In this study, we performed
Butian Li et al.
Biochemical and biophysical research communications, 484(2), 241-247 (2017-01-24)
MicroRNAs are aberrantly expressed in a wide variety of human cancers. The present study aims to elucidate the effects and molecular mechanisms of miR-144-3p that underlie gastric cancer (GC) development. It was observed that miR-144-3p expression was significantly decreased in
B Cheng et al.
European review for medical and pharmacological sciences, 24(18), 9361-9369 (2020-10-06)
MicroRNAs (miRNA) are aberrantly expressed in various human cancers, including colorectal cancer (CRC). We aim to investigate the functional role and underlying mechanism of miR-144 in CRC. The expressional level of miR-144 and pre-leukemia transcription factor 3 (PBX3) in CRC
Jinbao Wu et al.
Experimental cell research, 393(2), 112025-112025 (2020-04-24)
Colon cancer shows characteristics of metastasis, which is associated with angiogenesis. Increasing evidence highlights long non-coding RNAs (lncRNAs) as important participants in angiogenesis of cancers, including colon cancer. Hence, this study investigated the role of HNF1A-AS1 in angiogenesis of colon
Xiupeng Xu et al.
Journal of neuro-oncology, 135(3), 453-463 (2017-09-01)
Among primary brain tumors, gliomas are the most common and most aggressive, with a poor prognosis and limited treatment options. Thus, it is essential to determine the mechanisms involved in glioma development to develop effective therapies for glioma patients. Pre-B-cell
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service