Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGCCTCTGGAGGTTCTTCAGATAACTCTATTGAACACTCAGATTACAGAGCCAAATTGACCCAGATCAGACAAATCTATCACACAGAACTGGAGAAATATGAACAGGCATGTAATGAATTTACTACACATGTGATGAACCTTCTCCGAGAACAGAGTAGAACACGTCCCATTTCTCCAAAAGAGATTGAAAGAATGGTGGGCATCATCCATCGAAAATTTAGTTCCATTCAGATGCAGCTCAAACAAAGCACTTGTGAAGCAGTTATGATTTTAAGATCAAGGTTCCTTGATGCCAGACGGAAAAGGCGTAACTTCAGTAAACAGGCCACAGAAATCTTGAATGAATATTTTTACTCACACCTCAGCAACCCCTACCCCAGTGAAGAAGCCAAAGAGGAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PBX3(5090)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
B Cheng et al.
European review for medical and pharmacological sciences, 24(18), 9361-9369 (2020-10-06)
MicroRNAs (miRNA) are aberrantly expressed in various human cancers, including colorectal cancer (CRC). We aim to investigate the functional role and underlying mechanism of miR-144 in CRC. The expressional level of miR-144 and pre-leukemia transcription factor 3 (PBX3) in CRC
Butian Li et al.
Biochemical and biophysical research communications, 484(2), 241-247 (2017-01-24)
MicroRNAs are aberrantly expressed in a wide variety of human cancers. The present study aims to elucidate the effects and molecular mechanisms of miR-144-3p that underlie gastric cancer (GC) development. It was observed that miR-144-3p expression was significantly decreased in
Zhuochao Zhang et al.
Cancer letters, 397, 33-42 (2017-03-16)
Cancer-associated fibroblasts (CAFs) play a pivotal role in regulating tumour progression. Therefore, understanding how CAFs communicate with hepatocellular carcinoma (HCC) is crucial for HCC therapy. Recently, exosomes have been considered an important "messenger" between cells. In this study, we performed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU083631-50UG | 04061828395385 |
| EHU083631-20UG | 04061828619566 |