Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGGCCCTTACCATTATCCGCAGAGGTGGTGATTTGACTAACACTGTGTTTGTTGACTTCAGAACAGAGGATGGCACAGCAAATGCTGGGTCTGATTATGAATTTACTGAAGGAACTGTGGTGTTTAAGCCTGGTGATACCCAGAAGGAAATCAGAGTGGGTATCATAGATGATGATATCTTTGAGGAGGATGAAAATTTCCTTGTGCATCTCAGCAATGTCAAAGTATCTTCTGAAGCTTCAGAAGATGGCATACTGGAAGCCAATCATGTTTCTACACTTGCTTGCCTCGGATCTCCCTCCACTGCCACTGTAACTATTTTTGATGATGACCACGCAGGCATTTTTACTTTTGAGGAACCTGTGACTCATGTGAGTGAGAGCATTGGCATCATGGAGGTGAAAGTATTGAGAACATCTGGAGCTCGAGGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SLC8A1(6546)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Barbora Chovancova et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 763-777 (2017-11-24)
Melatonin is a hormone transferring information about duration of darkness to the organism and is known to modulate several signaling pathways in the cells, e.g. generation of endoplasmic reticulum stress, oxidative status of the cells, etc. Melatonin has been shown
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084891-50UG | 04061828387069 |
| EHU084891-20UG | 04061828620579 |