Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCCTCCAGAAAGTCGAGCAGCACCCACCTCCAACCTCGGGCCAGTGTCTTCAGGCTTTACTGGGGACCTGCGAGCTGGCCTAATGTGGTGGCCTGCAAGCCAGGCCATCCCTGGGCGCCACAGACGAGCTCCGAGCCAGGTCAGGCTTCGGAGGCCACAAGCTCAGCCTCAGGCCCAGGCACTGATTGTGGCAGAGGGGCCACTACCCAAGGTCTAGCTAGGCCCAAGACCTAGTTACCCAGACAGTGAGAAGCCCCTGGAAGGCAGAAAAGTTGGGAGCATGGCAGACAGGGAAGGGAAACATTTTCAGGGAAAAGACATGTATCACATGTCTTCAGAAGCAAGTCAGGTTTCATGTAACCGAGTGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGTGATT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IRAK1(3654)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hong-Yi Zhang et al.
Journal of pediatric surgery, 55(11), 2308-2316 (2020-04-24)
To investigate the effects of low dose endotoxin on transcriptional activity in intestinal epithelium, and its role in necrotizing enterocolitis (NEC). Lipopolysaccharides (LPS) were injected into the amniotic cavity of pregnant mice under ultrasound guidance. The effects of LPS on
Wei Chen et al.
OncoTargets and therapy, 13, 12787-12796 (2020-12-29)
Interleukin-1 receptor-associated kinase 1 (IRAK1) was shown to contribute to a variety of cancer-related processes. However, the function of IRAK1 in hepatocellular carcinoma (HCC) pathogenesis has not been investigated in detail. IRAK1 expression in HCC was examined by immunohistochemistry, qRT-PCR
Xian Shuang Liu et al.
Molecular neurobiology, 54(1), 227-237 (2016-01-08)
Stroke induces new myelinating oligodendrocytes that are involved in ischemic brain repair. Molecular mechanisms that regulate oligodendrogenesis have not been fully investigated. MicroRNAs (miRNAs) are small non-coding RNA molecules that post-transcriptionally regulate gene expression. MiR-146a has been reported to regulate
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU093291-50UG | 04061831374070 |
| EHU093291-20UG | 04061828597758 |