Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MYCN(4613)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yosuke Watanabe et al.
Medical oncology (Northwood, London, England), 34(9), 158-158 (2017-08-10)
Although DNA hypermethylation at non-promoter region of the Zygote arrest 1 (ZAR1) gene has been observed in many types of tumor, including neuroblastoma (NB), the role of this gene in tumor development and/or progression is unclear. One reason is that
Luca Montemurro et al.
Cancer research, 79(24), 6166-6177 (2019-10-17)
Approximately half of high-risk neuroblastoma is characterized by MYCN amplification. N-Myc promotes tumor progression by inducing cell growth and inhibiting differentiation. MYCN has also been shown to play an active role in mitochondrial metabolism, but this relationship is not well
Huogang Wang et al.
Oncotarget, 8(49), 86312-86324 (2017-11-22)
Small cell lung cancer (SCLC) is a clinically aggressive cancer with very poor prognosis. Amplification of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU093561-20UG | 04061828597932 |
| EHU093561-50UG | 04061831374094 |