Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGCACAAGGTGAAACAGCAGTTTATGACTACCCAAGATGCCTCTAAAGATGGTCGCATTCGGATGAAAGAGCTTGCTGGTATGTTCTTATCTGAGGATGAAAACTTTCTTCTGCTCTTTCGCCGGGAAAACCCACTGGACAGCAGCGTGGAGTTTATGCAGATTTGGCGCAAATATGACGCTGACAGCAGTGGCTTTATATCAGCTGCTGAGCTCCGCAACTTCCTCCGAGACCTCTTTCTTCACCACAAAAAGGCCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mourad Ferdaoussi et al.
Scientific reports, 7(1), 248-248 (2017-03-23)
Insulin secretion from pancreatic ß cells is a multistep process that requires the coordination of exocytotic proteins that integrate diverse signals. These include signals derived from metabolic control of post-translational SUMOylation and depolarization-induced rises in intracellular Ca
Andrew D Biancolin et al.
Molecular metabolism, 31, 124-137 (2020-01-11)
The incretin hormone glucagon-like peptide-1 (GLP-1) is secreted from intestinal L-cells upon nutrient intake. While recent evidence has shown that GLP-1 is released in a circadian manner in rats, whether this occurs in mice and if this pattern is regulated
Katarzyna Malenczyk et al.
The EMBO journal, 36(14), 2107-2125 (2017-06-24)
Ca
Sara F Hansson et al.
PloS one, 13(4), e0196601-e0196601 (2018-04-28)
Beta cell dysfunction accompanies and drives the progression of type 2 diabetes mellitus (T2D), but there are few clinical biomarkers available to assess islet cell stress in humans. Secretagogin, a protein enriched in pancreatic islets, demonstrates protective effects on beta
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service