Skip to Content
Merck
CN

EHU098031

Sigma-Aldrich

MISSION® esiRNA

targeting human SCGN

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGCACAAGGTGAAACAGCAGTTTATGACTACCCAAGATGCCTCTAAAGATGGTCGCATTCGGATGAAAGAGCTTGCTGGTATGTTCTTATCTGAGGATGAAAACTTTCTTCTGCTCTTTCGCCGGGAAAACCCACTGGACAGCAGCGTGGAGTTTATGCAGATTTGGCGCAAATATGACGCTGACAGCAGTGGCTTTATATCAGCTGCTGAGCTCCGCAACTTCCTCCGAGACCTCTTTCTTCACCACAAAAAGGCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mourad Ferdaoussi et al.
Scientific reports, 7(1), 248-248 (2017-03-23)
Insulin secretion from pancreatic ß cells is a multistep process that requires the coordination of exocytotic proteins that integrate diverse signals. These include signals derived from metabolic control of post-translational SUMOylation and depolarization-induced rises in intracellular Ca
Andrew D Biancolin et al.
Molecular metabolism, 31, 124-137 (2020-01-11)
The incretin hormone glucagon-like peptide-1 (GLP-1) is secreted from intestinal L-cells upon nutrient intake. While recent evidence has shown that GLP-1 is released in a circadian manner in rats, whether this occurs in mice and if this pattern is regulated
Katarzyna Malenczyk et al.
The EMBO journal, 36(14), 2107-2125 (2017-06-24)
Ca
Sara F Hansson et al.
PloS one, 13(4), e0196601-e0196601 (2018-04-28)
Beta cell dysfunction accompanies and drives the progression of type 2 diabetes mellitus (T2D), but there are few clinical biomarkers available to assess islet cell stress in humans. Secretagogin, a protein enriched in pancreatic islets, demonstrates protective effects on beta

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service