Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGCACAAGGTGAAACAGCAGTTTATGACTACCCAAGATGCCTCTAAAGATGGTCGCATTCGGATGAAAGAGCTTGCTGGTATGTTCTTATCTGAGGATGAAAACTTTCTTCTGCTCTTTCGCCGGGAAAACCCACTGGACAGCAGCGTGGAGTTTATGCAGATTTGGCGCAAATATGACGCTGACAGCAGTGGCTTTATATCAGCTGCTGAGCTCCGCAACTTCCTCCGAGACCTCTTTCTTCACCACAAAAAGGCCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SCGN(10590)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Andrew D Biancolin et al.
Molecular metabolism, 31, 124-137 (2020-01-11)
The incretin hormone glucagon-like peptide-1 (GLP-1) is secreted from intestinal L-cells upon nutrient intake. While recent evidence has shown that GLP-1 is released in a circadian manner in rats, whether this occurs in mice and if this pattern is regulated
Mourad Ferdaoussi et al.
Scientific reports, 7(1), 248-248 (2017-03-23)
Insulin secretion from pancreatic ß cells is a multistep process that requires the coordination of exocytotic proteins that integrate diverse signals. These include signals derived from metabolic control of post-translational SUMOylation and depolarization-induced rises in intracellular Ca
Sara F Hansson et al.
PloS one, 13(4), e0196601-e0196601 (2018-04-28)
Beta cell dysfunction accompanies and drives the progression of type 2 diabetes mellitus (T2D), but there are few clinical biomarkers available to assess islet cell stress in humans. Secretagogin, a protein enriched in pancreatic islets, demonstrates protective effects on beta
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU098031-20UG | 04061828588930 |
| EHU098031-50UG | 04061828354542 |