Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCAAGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACATCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTTCTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATAAGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATCATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CENPA(1058)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mamoru Takada et al.
Cancer research, 77(18), 4881-4893 (2017-08-02)
The centromere regulates proper chromosome segregation, and its dysfunction is implicated in chromosomal instability (CIN). However, relatively little is known about how centromere dysfunction occurs in cancer. Here, we define the consequences of phosphorylation by cyclin E1/CDK2 on a conserved
S Zachary Swartz et al.
Developmental cell, 51(1), 35-48 (2019-08-20)
Centromeres provide a robust model for epigenetic inheritance as they are specified by sequence-independent mechanisms involving the histone H3-variant centromere protein A (CENP-A). Prevailing models indicate that the high intrinsic stability of CENP-A nucleosomes maintains centromere identity indefinitely. Here, we
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU098081-50UG | 04061828354597 |
| EHU098081-20UG | 04061831356861 |