Skip to Content
Merck
CN

EHU105321

MISSION® esiRNA

targeting human PAFAH1B1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human PAFAH1B1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTCTGGCTTCCTGTTCTGCAGATATGACCATTAAACTATGGGATTTTCAGGGCTTTGAATGCATCAGAACCATGCACGGCCATGACCACAATGTTTCTTCAGTAGCCATCATGCCCAATGGAGATCATATAGTGTCTGCCTCAAGGGATAAAACTATAAAAATGTGGGAAGTGCAAACTGGCTACTGTGTGAAGACATTCACAGGACACAGAGAATGGGTACGTATGGTACGGCCAAATCAAGATGGCACTCTGATAGCCAGCTGTTCCAATGACCAGACTGTGCGTGTATGGGTCGTAGCAACAAAGGAATGCAAGGCTGAGCTCCGAGAGCATGAGCATGTGGTAGAATGCATTTCCTGGGCTCCAGAAAGCTCATATTCCTCCATCTCTGAAGCAACAGGATCTGAGACTAAAAAAAGTGGTAAACCTGGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kevin Kruse et al.
American journal of physiology. Lung cellular and molecular physiology, 317(3), L392-L401 (2019-07-18)
Here we describe a novel method for studying the protein "interactome" in primary human cells and apply this method to investigate the effect of posttranslational protein modifications (PTMs) on the protein's functions. We created a novel "biomimetic microsystem platform" (Bio-MSP)
Aditya Chhatre et al.
Cytoskeleton (Hoboken, N.J.), 77(7), 249-260 (2020-06-12)
Phagocytosis, the ingestion of solid particles by cells is essential for nutrient uptake, innate immune response, antigen presentation and organelle homeostasis. Here we show that Lissencephaly-1 (Lis1), a well-known regulator of the microtubule motor dynein, co-localizes with actin at the
Gui-Dong Yao et al.
Reproductive biomedicine online, 31(5), 613-624 (2015-09-19)
Spermatogenesis, fertilization and subsequent embryonic development are complex processes that require tight regulation. The PAFAH1B1 gene plays important roles in these reproductive events in mice, but its expression and roles in human reproduction have not been investigated. Expression analysis of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service