Skip to Content
Merck
CN

EHU106011

Sigma-Aldrich

MISSION® esiRNA

targeting human UQCRB

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGGGGTTAATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTTTATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTAAAGAGCAGTGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGGTTATTCGGGAAAGAAAAGAAAGAGAAGAATGGGCAAAGAAGTAATCATGTAGTTGAAGTCTGTGGATGCAGCTGTTATGAAGATGGTTAAACTTGAAACAAACAATTTTAAGAATTATTTGGTCTGAAGATGTTTTACTTTAAATAAATGTCTATTGTAATGGCTGGAGTTTTTGAATTCCAAACCTTATACTGAATAACTACTGAATCCCTTTACTGTTAAATTTTTTTCCAAACTTTCAAGATATATTTAGTTGTGTTTAACTGCTACTTGGAGCTCAGAAGCCACTTTATCAGTTTTCCTCACTGGTTGGATAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Frank Cichocki et al.
The Journal of experimental medicine, 215(9), 2379-2395 (2018-08-01)
Natural killer (NK) cells with adaptive immunological properties expand and persist in response to human cytomegalovirus. Here, we explored the metabolic processes unique to these cells. Adaptive CD3-CD56dimCD57+NKG2C+ NK cells exhibited metabolic hallmarks of lymphocyte memory, including increased oxidative mitochondrial
Meng Gao et al.
Journal of cellular physiology, 236(4), 2920-2933 (2020-09-16)
The previous research has shown that mitochondrial flash (mitoflash) genesis are functionally and mechanistically integrated with mitochondrial electron transport chain (ETC) energy metabolism. However, the response of mitoflash to superoxide is not entirely consistent with the response of MitoSOX Red.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service