Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TATCGGTACTGCCCAGAAGGAGTTCATAAAGAATACAAAGAAGACCCCAAAAGATGTCACGATGGCACTATTGAATTCACGAGCATCGATGCACACAATGGCGTGGCCCCATCAAGACGTGGTGATTTGGAAATACTTGGTTATTGCATGATCCAATGGCTTACTGGCCATCTTCCTTGGGAGGATAATTTGAAAGATCCTAAATATGTTAGAGATTCCAAAATTAGATACAGAGAAAATATTGCAAGTTTGATGGACAAATGTTTTCCTGAGAAAAACAAACCAGGTGAAATTGCCAAATACATGGAAACAGTGAAATTACTAGACTACACTGAAAAACCTCTTTATGAAAATTTACGTGACATTCTTTTGCAAGGACTAAAAGCTATAGGAAGTAAGGATGATGGCAAATTGGACCTCAGTGTTGTGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VRK1(7443)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sangsoon Park et al.
Science advances, 6(27) (2020-09-17)
Vaccinia virus-related kinase (VRK) is an evolutionarily conserved nuclear protein kinase. VRK-1, the single Caenorhabditis elegans VRK ortholog, functions in cell division and germline proliferation. However, the role of VRK-1 in postmitotic cells and adult life span remains unknown. Here
Gen Wang et al.
Breast cancer research and treatment, 175(3), 567-578 (2019-04-03)
In early stage, ERα-positive breast cancer, concurrent use of endocrine therapy and chemotherapy has not been shown to be superior to sequential use. We hypothesized that genetic biomarkers can aid in selecting patients who would benefit from chemo-endocrine therapy. Our
Takuyu Hashiguchi et al.
Molecular endocrinology (Baltimore, Md.), 30(10), 1070-1080 (2016-08-30)
Comparison of 11 human nuclear receptor amino acid sequences revealed a conserved phosphorylation motif within their DNA-binding domains as an intramolecular signal that regulates proteolytic degradation. Nuclear receptors use this signal to either degrade or proscribe degradation through either the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU119541-20UG | 04061831345469 |
| EHU119541-50UG | 04061828317745 |