Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... S100A4(6275)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Andy Chen et al.
Scientific reports, 7(1), 3459-3459 (2017-06-16)
To investigate phenotypic and genotypic alterations before and after bone metastasis, we conducted genome-wide mRNA profiling and DNA exon sequencing of two cell lines (TMD and BMD) derived from a mouse xenograft model. TMD cells were harvested from the mammary
Shasha Hou et al.
Laboratory investigation; a journal of technical methods and pathology, 98(8), 1025-1038 (2018-05-24)
As a member from S100 calcium-binding protein family, S100A4 is ubiquitous and elevated in tumor progression and metastasis, but its role in regulating obesity has not been well characterized. In this study, we showed that S100A4 was mainly expressed by
S100A4 Knockout Sensitizes Anaplastic Thyroid Carcinoma Cells Harboring BRAFV600E/Mt to Vemurafenib.
Xuelong Jiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(3), 1143-1162 (2018-09-10)
Anaplastic thyroid cancer (ATC), with 25% BRAFV600E mutation, is one of the most lethal human malignancies that currently has no effective therapy. Vemurafenib, a BRAFV600E inhibitor, has shown promise in clinical trials, including ATC patients, but is being hampered by
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU125681-50UG | 04061828358014 |
| EHU125681-20UG | 04061831359749 |