Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGGGGGCTTTACAATCCTAAGGTTGGCGTTGTAATGAAGTTCCACTTGGTTCAGGTTTCTTTGAACTGTGTGGTCTCAATTGGGAAAATATATTTCCTATACGTGTGTCTTTAAAAAAAAATGTGAACAGTGAACGTTTCGGTTGCTGTGACTGGGAAGTTGTTGGGTGTGCTTTTTCAGCCAGCTTCTCCTTCCACTGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FZD5(7855), FZD5(7855)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiaozhu Liu et al.
International journal of clinical and experimental pathology, 13(5), 889-895 (2020-06-09)
To explore the effects of miR-149 on the cell proliferation and apoptosis of colorectal cancer (CRC) and its potential molecular mechanism. miR-149 expression patterns were detected in human CRC cell lines by quantitative real-time RT-PCR (Q-PCR). Online prediction software and
Qing-Zhi Long et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7017-7026 (2015-04-12)
Renal cell carcinoma (RCC) is one of most malignant neoplasms, exhibiting poor responsiveness to the conventional chemo-regime. Abnormal expression of P-glycoprotein (P-gp) has been implicated in the emergence of multiple-drug resistance (MDR) by reducing the accumulation of intracellular chemotherapy drugs.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service